domingo, 21 de enero de 2018

Cultura científica 1º bloque Revolución GENÉTICA Test


Bloque 4. La revolución genética


Criterios de evaluación

1. Reconocer los hechos históricos más relevantes para el estudio de la genética.
2. Obtener, seleccionar y valorar informaciones sobre el ADN, el código genético, la ingeniería
genética y sus aplicaciones médicas.
3.  Conocer  los  proyectos  que  se  desarrollan  actualmente  como  consecuencia  de  descifrar el
genoma humano, tales como HapMap y Encode.
4. Evaluar las aplicaciones de la ingeniería genética en la obtención de fármacos, transgénicos
y terapias génicas.
5. Valorar las repercusiones sociales de la reproducción asistida, la selección y conservación de
embriones.
6. Analizar los posibles usos de la clonación.
7.  Establecer  el  método  de  obtención  de  los  distintos  tipos  de  células  madre,  así  como  su
potencialidad para generar tejidos, órganos e incluso organismos completos.
8.  Identificar  algunos  problemas  sociales  y  dilemas  morales  debidos  a  la  aplicación  de  la
genética: obtención de transgénicos, reproducción asistida y clonación.
Estándares de aprendizaje evaluables
1.1. Conoce y explica el desarrollo histórico de los estudios llevados a cabo dentro del campo
de la genética.
2.1.  Sabe  ubicar  la  información  genética que  posee  todo  ser  vivo,  estableciendo  la  relación
jerárquica entre las distintas estructuras, desde el nucleótido hasta los genes responsables de
la herencia.
3.1.  Conoce  y  explica  la  forma  en  que  se  codifica  la  información  genética  en  el  ADN  ,
justificando  la  necesidad  de  obtener  el  genoma  completo  de  un  individuo  y  descifrar  su
significado.5
4.1.  Analiza  las  aplicaciones  de  la  ingeniería  genética  en  la  obtención  de  fármacos,
transgénicos y terapias génicas.
5.1. Establece las repercusiones sociales y económicas de la reproducción asistida, la selección
y conservación de embriones.
6.1. Describe y analiza las posibilidades que ofrece la clonación en diferentes campos.
7.1. Reconoce los diferentes tipos de células madre en función de su procedencia y capacidad
generativa, estableciendo en cada caso las aplicaciones principales.
8.1.  Valora,  de  forma  crítica,  los  avances  científicos  relacionados  con  la  genética,  sus  usos  y
consecuencias médicas y sociales.
8.2.  Explica  las  ventajas  e  inconvenientes  de  los  alimentos  transgénicos,  razonando  la
conveniencia o no de su uso.

Adelanto del bloque del bloque TIC

   Para que lo pienses con tiempo:

-Existe la posibilidad de hacer un curso online para este tema 

link
        LA REVOLUCIÓN GENÉTICA


CURSO 2017/ 2018


   Los genes no nos determinan sólo nos influyen. Son un potencial moldeado por el entorno.

 Diagnosis inicial:
1. ¿Sabes por qué nos parecemos a nuestros padres?
2. ¿Sabrías explicar qué se entiende por ADN, cromosoma y gen?
3. ¿Qué es para ti la ingeniería genética?
 4. ¿Sabrías decir cómo se pueden manipular genéticamente los organismos?
 5. ¿Sabes a qué se dedica la biología molecular?
6. ¿Sabes qué es el proyecto Genoma Humano?
7. ¿Qué entiendes por células madres embrionarias? ¿Sabrías decir de dónde se obtienen?
8. ¿Sabes qué es un niño probeta?
9. ¿Sabes si los hermanos gemelos son clónicos?
10. ¿Sabes lo que representan la siguiente imágen?




Libro de texto


Parte 1
Parte 2



25 de abril dia mundial del ADN

Preguntas:



Sigamos con otro vídeo(programa tres14-La herencia)




Contesta a las siguientes preguntas:


Tareas

Tareas para todos los bachilleratos.


CC tarea 1

¿Qué es la clonación?

Si nos referimos al ámbito de la Ingeniería Genética, clonar es                 
aislar y multiplicar en tubo de ensayo un determinado gen o, en
general, un trozo de ADN. Sin embargo, Dolly no es producto de
Ingeniería Genética. En el contexto a que nos referimos, clonar
significa obtener un individuo a partir de una célula o de un núcleo
de otro individuo.
En los animales superiores, la única forma de reproducción es
la sexual, por la que dos células germinales (óvulo y espermatozoide)
se unen, formando un zigoto (o huevo), que se desarrollará
hasta dar el individuo adulto. Las células de un animal proceden
en última instancia de la división repetida y diferenciación
del zigoto. Las células somáticas, que constituyen los tejidos del
animal adulto, han recorrido un largo camino “sin retorno”, de
modo que, a diferencia de las células de las primeras fases del embrión,
han perdido la capacidad de generar nuevos individuos y cada
tipo se ha especializado en una función distinta (a pesar de que,
salvo excepciones, contienen el mismo material genético).
No es extraño pues el revuelo científico cuando el equipo de
Ian Wilmut, del Instituto Roslin de Edimburgo comunicó que
habían logrado una oveja por clonación a partir de una célula
diferenciada de un adulto. Esencialmente el método (que aún
presenta una alta tasa de fracasos) consiste en obtener un óvulo
de oveja, eliminarle su núcleo, sustituirlo por un núcleo de célula
de oveja adulta (en este caso, de las mamas), e implantarlo en
una tercera oveja que sirve como “madre de alquiler” para llevar
el embarazo. Así pues, Dolly carece de padre y es el producto de
tres “madres”: la donadora del óvulo contribuye con el citoplasma
(que contiene, además mitocondrias que llevan un poco de
material genético), la donadora del núcleo (que es la que aporta
la inmensa mayoría del ADN), y la que parió, que genéticamente
no aporta nada.
Científicamente se trata de un logro muy interesante, ya que
demuestra que, al menos bajo determinadas circunstancias es posible
“reprogramar” el material genético nuclear de una célula
diferenciada (algo así como volver a poner a cero su reloj, de
modo que se comporta como el de un zigoto). De este modo, este
núcleo comienza a “dialogar” adecuadamente con el citoplasma
del óvulo y desencadena todo el complejo proceso del desarrollo
intrauterino.

1. Señala los términos incluidos en el texto que no podrías explicar bien lo
que significan.
2. Indica qué afirmaciones o argumentos no crees comprender bien.
3. Selecciona una idea de cada párrafo que consideres relevante como
síntesis de lo que expone.
4. De las ideas que expresa el texto: ¿cuál o cuáles te sorprenden más?
5. ¿Hay aspectos sobre los que te gustaría tener más información?
6. ¿Qué crees haber aprendido al hacer este análisis?

Tarea  "Clones"
   Vamos a poner un interesante documental en el que tratarás de contestar a las siguientes preguntas. Haremos paradas de 10' tiempo para corregirlas.

1-¿Qué procedimientos de clonación hay?¿Cual defiende" Supermán"?
2-¿Qué dice Vivianne sobre los hijos?
3-¿Cómo llamamos a los clones naturales?
4-¿Qué curiosa técnica emplea un investigador (Hans) para separar células de un embrión?
5-¿Cuántas veces se hubo de repetir el experimento de clonar una oveja?¿Salió Dolly completamente sana?
6¿De qué porcentaje sobre anormalidad humana se habla en el docu?
7-¿Por qué no son idénticos los clones de la vaca del docu)
8-¿Qué es una quimera?
9-¿En qué año nació el primer clon de gato?¿Clonarías tu mascota muerta?
10-Por qué desconfía algún científico de la clonación de animales (en vías de extinción)?

Tarea 2 Leer el siguiente texto.

4-El pasado 27 de marzo de 2015 se les concedió el Premio Princesa de Asturias de Investigación Científica y Técnica a una bioquímica francesa y a una bióloga molecular estadounidense. Estas dos investigadoras han desarrollado un método complejo para modificar las secuencias de ADN de prácticamente cualquier organismo. Esta técnica llamada CRISPR-Cas (en inglés: clustered regularly interspaced short palindromic repeats) no es la primera que consigue modificar el genoma de las células, pero su principal diferencia es que se trata de una herramienta barata, precisa y fácil de usar; su utilización es similar a la de un procesador de texto en el que se selecciona una frase y se añaden o suprimen caracteres.
Sus aplicaciones van desde la mejora del rendimiento agrícola a la terapia génica o la modificación de cualquier característica en humanos (o cualquier otro ser).
Hace tres años se sentaron las bases de este método y se ha avanzado mucho hasta el día de hoy, pero, a pesar de las múltiples investigaciones en la materia, los científicos advierten que no está listo para aplicarse en humanos porque no esta garantizado que sea totalmente seguro. Además, la ciencia tiene mucho que debatir con el gobierno y los comités éticos sobre la aplicación de estas técnicas en los seres vivos, ya que sus posibilidades van mucho más allá de lo que se pueda imaginar.
1-De qué crees que va el texto.
2-Qué opinas de la frase subrayada.




Tareas para bachilleratos de humanidades.





Tarea 1  BIOÉTICA

¿La ciencia es “buena” o “mala”? ¿Es importante  establecer límites éticos y morales al desarrollo tecnológico y científico? El concepto de Bioética es relativamente reciente.
1.- ¿Qué es la Bioética?
2.- ¿Cuáles son los cuatro principios fundamentales de la Bioética? Resúmelos.
3.-Para que los de Humanidades se luzcan:
Primum non nocere.
¿Qué significa esta frase latina? ¿A quién se le atribuye?
4.- ¿Quién era Hipócrates? ¿Qué es el juramento hipocrático?
5.- En el juramento hipocrático se hace referencia a Apolo el Médico, Esculapio, Hygeia y Panacea. ¿Quiénes eran estos personajes?
6.- ¿Se sigue utilizando en la actualidad el juramento hipocrático, o ha sido sustituido por alguna otra fórmula?


Tarea 2
-La etnia de los judíos asquenazíes representan el 3% de la población y poseen el 30% de los premios Nóbel ,el 25% de los premios Turing y el 50% de los de ajedrez .Realiza una investigación y propón una explicación desde el punto de vista del neodarwinismo(selección natural + mutaciones).



Tarea 3
-Vas a representar el papel de un agente comercial, presentando una determinada empresa, y si tienes dotes, vender un producto.



  Puedes elegir entre las siguientes:



-Mycovitro.

-Genycell Biotech.

-Lorgen.

-Sistemas genómicos.

-Genómica.

-Labgenetics.

-Syngenta.

-Valentia.

   Para todos los bachilleratos

  Presentación del programa En ruta con la ciencia.



Tarea 1 -El dopaje genético es el uso no terapéutico de la terapia génica para mejorar el rendimiento atlético. Esto se consigue mediante la introducción de un gen artificial en el cuerpo que modifica la expresión génica.
El desarrollo de las terapias genéticas han hecho saltar las alarmas en el deporte, donde se puede abusar de ella, se denomina terapia génica a la transferencia de material genético por medio de vectores a determinados tejidos o células para el tratamiento o prevención de una enfermedad o trastorno.[
A día de hoy son muchos los estudios sobre terapia génica. Los primeros fueron con la eritropoyetina (EPO) y la hormona del crecimiento (muy utilizadas en el doping convencional), por lo que vemos que terapia génica y deporte desde primer momento se encuentran estrechamente ligados.
Actualmente esta transferencia de genes tiene unos resultados “inmaduros”, todavía se desconocen todos los problemas y riesgos.
    El Comité Olímpico Internacional tiene prohibido el dopaje genético desde 2003.
a)      Busca algún caso sonado en la red describiendo los pasos que siguieron las autoridades para descubrirlo.



















Docu de 50' Dopaje genético.
Cuestiones:
1-¿En qué parte de la célula realiza su función el ARN?
2-¿Qué hace la hormona eritropoyetina?
3-¿Cuál es el gen, cuya mutación, es la responsable de los "bebes culturistas"
4-¿Qué  "vehículo" se utiliza para introducir genes en un individuo?
5-¿Qué es el dilema de Goldman?
6-¿Qué esperanza de vida tienen los afectados por distrofia muscular de Duchenne?
7-¿Cuál fue el primer tipo de enfermedades en las que se intentó la terapia génica?




Tarea 2El cariotipo humano y las mutaciones genómicas.
   Se define cariotipo como el conjunto de cromososmas(nº,forma,tamaño) que caracteriza a un individuo.Las mutaciones genómicas son aquellas en las que se afecta el nº  o juegos de cromosomas.

Ejemplo de cariotipo humano:



  A partir de esta introducción haz las actividades de este enlace

Una vez hechas contesta a las siguientes preguntas:
a) Qué término se utiliza para designar las mutaciones genómicas en las que varía el juego de cromosomas.Cuantos juegos tendrá un ser vivo tetraploide?
b)  Qué término se utiliza para designar las mutaciones genómicas que a fectan a los animales como los seres humanos?

3-Anális del material genético
    

    Busca el cromosoma donde está la hemofilia en esta  página de la web del Human Genome  pulsando sobre él con el botón derecho del ratón podrás aumentarlo de tamaño hasta que puedas leer el nombre de la enfermedad; bajando hacia abajo llegarás a la localización aproximada de los genes responsables de la hemofilia. Según bajas verás muchas otras enfermedades que, por el hecho de estar en el cromosoma X, van a afectar de forma diferente a mujeres y hombres. 

  Voluntario:
Entra en la web de la Federación Española de Hemofilia pulsa en el apartado "¿Qué es la hemofilia?" y podrás leer una explicación sobre las causas de esta enfermedad, y la diferencia entre el tipo A y el B. En esta otrapágina de la web puedes ver cómo se distribuye la enfermedad entre las casas reales emparentadas con la reina Victoria de Inglaterra, entre ellas la española. 

tarea 6-Alimentos transgénicos




 Tareas para el bachillerato de ciencias y/o tecnológico


Pregunta 1:

La clave de la transgénesis, la obtención de un organismo genéticamente modificado, está en extraer genes de interés de un organismo e introducirlos en otro, de modo de obtener un producto con características mejoradas. Pero ¿cómo se hace para "cortar" ADN de un organismo e insertarlo en otro? Los genetistas necesitaban herramientas para hacerlo, y así descubrieron las enzimas de restricción, las “tijeras moleculares” que cortan el ADN. De esta forma, es posible extraerlo del genoma de un organismo. También descubrieron las enzimas ligasas que "pegan" el fragmento de ADN aislado dentro del ADN del nuevo organismo. 

La siguiente secuencia corresponde a una molécula de ADN de cadena doble de un determinado organismo:
  
   5´ ------------------------------------------------------------------------------------- 3´
        A   T   G   A    A   T    T   C   G   A   A   G   C   T    T   G
        T   A   C   T    T    A   A   G   C   T   T   C   G   A   A   C
   3´ ------------------------------------------------------------------------------------- 5´

  Consultando la tabla siguiente, contesta a las cuestiones:


a) ¿Qué fragmentos de restricción se originarán tras la incubación de la molécula de ADN con la endonucleasa de restricción EcoRI?
b) ¿Y si se utiliza Hind III?

Pregunta 2:
¿Existe alguna relación entre la secuencia de bases de una cadena de ADN, la secuencia de bases de una molécula de ARNm y la secuencia de aminoácidos de una proteína?¿Qué dos palabras se pueden usar para responder a a la última pregunta?
Pregunta 4:


Pregunta 5:
La biotecnología actual permite crear copias de animales gracias a una técnica que se conoce como:

a) Duplicación.
b) Transgénesis.
c) Clonación.

Pregunta 6:
Una parte del genoma humano no tienen función conocida y representa el:

a) 95% del genoma.
b) 33,5% del genoma.
c) 99,99% del genoma.

Pregunta 7:
Cualquier molécula de ADN formada por la unión de segmentos de ADN de origen diferente es:

a) ADN basura.
b) ADN recombinante.
c) ADN complementario.

Pregunta 8:
¿Sabrías explicar qué es un animal knockouty para que se diseñan?
Pregunta 9:
El sida y la “enfermedad de las vacas locas” nos han demostrado lo fácil que es para las enfermedades saltar de una especie a otra, con gravísimas consecuencias.
Si trasplantar un corazón de cerdo transgénico a una persona, posiblemente, sería un éxito, ¿por qué crees que aún no se ha realizado esta operación?

Pregunta 10:
Construye las dos cadenas de ADN del cual se obtuvo por un proceso de transcripción la siguiente secuencia de ARN:
      
AUGCCUAGGCUCAAUACGGUGA


Test 


GENÉTICA CITOLÓGICA Y MOLECULAR



 -¿Qué son los ácidos nucleicos?a)Biomoléculas poliméricas constituidas de nucleótidos b)Están el ADN y el ARN C)Las dos anteriores
 -¿ Qué es un nucleótido?a) Son los componentes de los ácidos nucléicos. b) Son moléculas orgánicas formadas por la unión covalente de un monosacárido de cinco carbonos , una base nitrogenada y un grupo fosfato.c) a y b
 -¿Cuáles son los tipos de ARN?a) Mensajero, viajero y ribosomal.b) Mensajero, transferente y ribosomal.c) Mensajero, viajero y transferente.
- ¿Qué forma tiene la estructura del ADN y de que esta formada?a) Doble hélice, formada por nucleótidos de Adenina Guanina Citosina y Uracilo.b) Circular, formada por nucleótidos de Adenina Guanina Citosina Timina y Uraciloc) Doble hélice, formada por nucleótidos de Adenina Guanina Citosina y Timina
- ¿Cuáles son las bases nitrogenadas del ADN?a) ATDG.b) ANDG.c) ATCG
 - ¿Qué es un gen?a) Un fragmento de ADN.b)Unidad de información en el material genético c) Las dos son correctas.
 -¿Cuál de estas es la definición de gen?
a) Es  una secuencia determinada de nucleótidos.(fragmento de ADN). 
b) Es todo el material genético contenido en las células de un organismo en particular.
c) Es cada uno de los pequeños cuerpos en forma de bastoncillos en que se organiza la cromatina del núcleo celular durante las divisiones celulares (mitosis y meiosis).

 -¿Qué es un alelo?a) Cada uno de los genes que, situados en el mismo lugar de los cromosomas homólogos , regulan la misma función. b)  ARN tomando como molde  una hebra de ADN.c) Un atonto.

-¿Cuántos cromosomas tienen las células somáticas de un individuo?A- 46 B- 44 C- 48 
- Los seres humanos tenemos en nuestras células.A- 46000 genes y 23 autosomas.B- 25000 genes y 44 autosomas.C- 25000 genes y 46 cromosomas sexuales.
 -¿Cuál de estas es la definición de genoma?
a) Es todo el material genético contenido en las células de un organismo/especie en particular.
b) Es el conjunto de una secuencia determinada de nucleótidos de uno de los lados de la escalera del cromosoma referenciado.
c) Es cada uno de los pequeños cuerpos en forma de bastoncillos en que se organiza la cromatina del núcleo celular durante las divisiones celulares (mitosis y meiosis).-¿Cuál de estas es la definición de cromosoma?
a) Es cada uno de los pequeños cuerpos en forma de bastoncillos en que se organiza la cromatina del núcleo celular durante las divisiones celulares (mitosis y meiosis).
b) Es el conjunto de una secuencia determinada de nucleótidos de uno de los lados de la escalera del cromosoma referenciado.
c) Es todo el material genético contenido en las células de un organismo en particular.

 -De los conceptos siguientes ¿Cuál alude al nivel de complejidad  más sencillo?a) Gen b) Cromosoma c) Célula.


EXPRESIÓN DE LA INFORMACIÓN GENÉTICA


-¿Qué es el código genético? a) Un conjunto de normas que obedecen los genes b) La correspondencia entre la información de los genes y su traducción a proteínas c) Las leyes de la herencia


 -¿Qué quiere decir ADN basura? A- ADN que se ha producido por la multiplicación bacteriana.B- ADN sin actividad biológica.C- ADN del que se sospechan funciones aún no enteramente conocidas.
-El proceso de síntesis de proteinas se denomina:a) replicacion.b) traduccion.c) transcripcion.








- ¿Qué enzima interviene en la trascripción?A- ADN polimerasa.B- transcriptasa inversa.C- ARN polimerasa
 -¿Mediante que proceso se lleva a cabo la copia  del ADN?
A) Mitosis B) Reproducción sexual C) Replicación.


 

La expresión génica: Replicación y transcripción del ADN y la traducción del ARNm a porteínas
 -¿Qué macromolécula es sintetizada y que enzima intervienen en el proceso de transcripción?
A) ADN y ADN polimerasaB) ARNm y ARN polimerasa C) ADN y ARN 

-
 -¿Qué es el ADN recombinante?A) Moléculas que son sintetizadas por bacterias para proteger su ADN de otro ADN invasor.B) Molécula de ADN formada por la union de segmentos de ADN de origen diferente.C) Moléculas que unen distintos fragmentos de ADN pegando sus extremos.-¿Qué proceso se encarga del paso de ARNm a ADN?a) Retrotranscripción o trascripción inversa.b) Replicación.c) Traducción

Descubridor de la retrotranscriptasa.



- Al conjunto de 3 nucleótidos que codifican un aminoácido se les llama: a) Transcriptasa b) Codón. c) Intrón.
-¿Cuáles son los tipos de mutaciones que existen?a) Genéticas ,cromosómicas y numéricasb) Génicas cromosómicas y numéricas.c) Genéticas cromosómicas y anuméricas.

-¿Cuántos aminoácidos diferentes  forman  las proteínas?a) 25.b) 30.c) 20.- ¿Qué es una enzima?
a) Es un tipo de proteína que hace posible una reacción química y ésta reacción determina un/os carácter/es en un ser vivo.b) Es un nucleótido.c) Es un fragmento de ADN.
  También hay coenzimas p.ej. sin Vit C la enzima prolil hidroxilasa no funciona y no se produce colágeno.

-¿Qué porcentaje del genoma está formado por ADN basura? a) 95%.b)50%.c) 5%-
-¿De qué se ocupa el Proyecto Genoma Humano? : a)De la clonación de partes del ADN humano con fines terapéuticos .b)De la secuenciación de la totalidad de la información genética del ser humano .c)De la síntesis de genes humanos en laboratorio.

Doc Cromosoma cinco RTVE


HISTORIA,DESCUBRIMIENTOS Y GENÉTICA SOCIAL

 -¿Quién fue Mendel? A- Descubridor de las leyes de la herencia.B- Padre de la biología molecular.C- Enunciador de la teoría de la evolución de las especies.

-¿Qué significa PGH?A- Proyecto genoma humano. B- Proyecto gen humano C- Proyecto humano genómico

 -¿Quién descubrió los genes saltarines? a)Thomas Morgan(1910) b)Barbara McClintoch c)Tatum y Beadle




 2.¿Quiénes obtuvieron el premio nobel por el descubrimiento de la estructura del ADN?a) Watson y Crick.b) Crick y Franklin.c) Watson y Franklin.
Rosalind Franklin obtiene la 1ª "mágen" del ADN.



-¿Quién descubrió los cromosomas sexuales?: a) Walter Flemming(1900) b) Walter Sutton(1902) c)Nettie Stevens(1905).


- ¿Qué es la eugenesia? 
a)Es el conjunto de técnicas encaminadas a mejorar la naturaleza de la especie humana.b)Es la ciencia de los genes c)Es la verdadera ciencia de los genes-

-¿Qué es la bioética ?a) Disciplina basada en los valores y principios morales  que han de regir la conducta humana en temas sobre biología.b) Son los principios de no maleficiencia y de justicia.c) La moral biológica.

Ver película reducida La decisión de Anne.
Antes ppt sobre trabajo en grupos

- ¿En que año nació la primera niña probeta?a) 1978. b) 1979. c) 1977.(tb es el año en que se identifica el 1er gen humano).




Desde entonces han nacido más de 5 millones de niños.



-¿Cuándo es descifrado por completo el genoma humano? A- 1993.B- 2001 C- 2003.
-¿Cuándo se aplica por primera vea la prueba del ADN en un juicio?a) 1970 b) 1980 c) 1985.

ESPECIAL CLONACIÓN

 -¿Qué son las células somáticas? A- Son las reproductoras o geminativas.B-Todas células de un ser vivo exceptuando las anteriores.C- Las llamadas células madre.
-¿Cuántas células se formaran después de 10 mitosis sucesivas sufridas por el cigoto a) 1024 (2exp10) b) 20.c) ninguna de las anteriores es correcta.
-¿Qué células tienen capacidad de multiplicarse, desarrollarse, y diferenciarse dando lugar a células de otros tejidos? A- Células madre.B- Células hembra.C- Células padre.
 -¿Como se llama al proceso para obtener células madre a partir de celulas adultas?:a)Diferenciación.b)Reimplatación.c)Reprogramación.
  -Quien realizo la primera clonación en mamíferos a partir de células diferenciadas?:a) Ian Wilmut. b) Francis Crick. c)James  Watson.(Ya a finales del s., XIX se trasfieren los primeros embriones de conejo y mediados del XX 1ª clonación a partir de células embrionarias)

1997 nacen los clónicos Neti y Ditto

-¿Qué tipo de clonación busca poder curar enfermedades o reemplazar órganos?
A) Terapeútica B) Reproductiva C) Curativa


GENÉTICA APLICADA

- Los niños probeta son concebidos mediante:A- Inseminación artificial.B- Fecundación in Vitro.C- Clonación.(De mediados del s.XX  son las I.A )
-La gametogénesis in vitro (IVG) tiene como objetivo: a)Producir óvulos a partir de otras células b)
Producir espermatozoides  a partir de otras células c) Lo mismo que la FIV d) a y b
-¿Qué es la terapia génica?a) Es el proceso por el cual se sintetizan dos copias idénticas de ADN tomando como modelo otra cadena de ADN. b)  Clonación humana con fines terapeúticos. c) Consiste en modificar los genes anómalos para impedir que se manifieste una enfermedad o para curarla una vez manifestada. 
-¿Qué es una célula madre?a)Son células que se encuentran en todos los organismos pluricelulares b)Células que tienen la capacidad de dividirse (a través de la mitosis) y diferenciarse en diversos tipos de células especializadas.c) En inglés stem cells (donde stem significa tronco, traduciéndose a menudo como «células troncales»)d)Todas
- ¿Qué puede obtenerse con los animales transgénicos ?A- órganos de trasplante a los humanos.B-Fármacos.C- A y B son correctas.
El ‘niño mariposa’ que regeneró el 80% de su piel gracias a células madre transgénicas

Vídeo


 Docu "La granja del Dr. Frankenstein" 101'
  Cuestiones:

1) ¿A qué se dedican los presentadores del documental?
2) ¿Qué son las blanco azul Belga?
3) ¿Qué animal del documental es un transgénico?
4) ¿Para que sirve conseguir conejos luminiscentes?
5) ¿Qué beneficios medio ambientales tiene la cria de salmones transgénicos?
6) ¿Qué son los purines y qué sustancia perniciosa contienen?
7) ¿Qué es el ecocerdo y cómo se ha conseguido?
8) ¿Cómo se consigue el arroz dorado?
9) ¿Qué tiene de especial el caballo que pretenden clonar?
10) ¿Qué dos tipos de carne come el protagonista?
 

-¿En qué campos aplicamos la biotecnología?
A) Medicina e industria.B) Medio ambiente, agricultura y ganadería.C)Todas las opciones anteriores son correctas.




 
-¿Cual es la función de las enzimas de restricción?
A)Funcionan como tijeras químicas que cortan el ADN extraño en fragmentos cuyos extremos pueden unirse con el extremo de otro fragmento de ADN.
B) Permiten mantener y crecer "in vitro" células,órganos y embriones durante largos periodos de tiempo.
C) Funcionan como reparadoras del tejido y óganos adultos dañados o defectuosos.
Hamilton Smith.P.N por su descubrimiento.
CCBB
CS,CD,CMCT

¿Qué es CRISPR?¿ y Francisco Mojica?


- Hormona obtenida mediante la tecnología del ADN a) Antibiótico b) antitripsina c) insulina.


Descubren los genes discontinuos.Intrones y exones.
- Cual seria la reproducción asistida que aplicarías en una pareja en la que no hay causa de esterilidad:A- Inseminación artificial B- Estimulación ovárica y sexualidad dirigida C- Transferencia de embriones donados.

-Tipo de fecundación basada en una unión del óvulo y espermatozoide en un laboratorio…
a) Fecundación en Vitro.b) Fecundación in Vitro.c) Fecundación in Votrio.d) Bodrio de fecundación.


SECCIÓN EN RUTA CON LA CIENCIA PROGRAMA FERTILIDAD

- La ley de Repredución Humana Asistida permite la transferencia al útero de: A- Hasta tres embriones B- No existe esta ley C- No hay límite.

-La clonación humana con fines reproductivos.a) Está prohibida y no cuenta con el apoyo de la comunidad cientifica.b) Es eugenesia.c) Sólo es legal en algunos paises.

Una técnica de reproducción asistida utiliza el ADN de dos madres y de un padre

03 feb 2015



- La reacción en cadena de polimerasa(PCR) permite:a) obtener millones de copias de un segmento especifico de ADN mediante un proceso denominado transformacion.b) obtener millones de copias de un segmento de ADN mediante repeticion de multiples ciclos de replicacion de ADN in vitroc) obtener millones de copias de un segmento especifico de ADN mediante biblioteca o genotecas de ADN.



Kary Banks Mullis.Inventa la técnica de la PCR.


-¿Cuánto cuesta a día de hoy(2017) una prueba de paternidad?a) 100 € b) 200€ c) 300
-¿Cuándo se puede hacer la prueba? a) Nada más nacer b)  Cuando sospechas c) Antes de nacer. 
Dalí pinta en 1959 para Severo Ochoa.



Desarrolla el primer método de secuenciación del ADN.Galardonado dos veces con el nóbel.
-La ingeniería genética se define como:a) La ciencia biológica que trata de la manipulación de los genes.b) La tecnología de la manipulación y transferencia de ADN de un organismo a otro, que posibilita la creación de nuevas especies.c) Una parte de la biotecnología que se basa en la manipulación genética de organismos con un propósito predeterminado, aprovechable por el hombre.d) Todas las anteriores son ciertas.

-Son aplicaciones de la ingeniería genética :a) Obtención de proteínas de interés médico y económico como antibióticos , enzimas, hormonas…b) Mejora de animales y vegetales para obtener una mayor producción y mejor calidad.c) Biodegradación de residuos. d)Tratamiento de enfermedades como algunos cánceres, hemofilia, diabetes, sida…e) Todas.
-Son riesgos de la Ingeniería Genética :a) Productos de consumo humano poco experimentados sobre sus posibles consecuencias para nuestra salud. b) Monopolización de la información con la intervención de grandes multinacionales farmacéuticas y químicas y explotación de recursos del tercer mundo.c) Peligro de manipular virus y bacterias patógenos .d)Todas las anteriores. 




Docu "Somos lo que comemos 43'

Cuestiones:
1-¿Qué problema tienen los indios emigrantes a Gran Bretaña referente a su alimentación vegetariana?
2-¿Qué producto consumen los japoneses que reduce la incidencia de cáncer?
3-¿Qué acontecimiento fue el responsable de que en China en los años 70 hubiera más casos de esquizofrenia?
4-¿Qué alimento tuvo que importar la reina Catalina de Médicis para aumentar la supervivencia de sus hijos?
5-¿Qué sustancia se encuentra en los biberones que es perjudicial para la salud?
6-Nombra tres alimentos que ayuden a reducir la probabilidad de tener ciertos cánceres.


-La epigenética es:a) Parte de la genética que estudia la superficie en la herencia de los caracteres.b)  Parte de la genética que estudia los factores ambientales en la herencia de los caracteres.c) Parte de la genética que estudia el comportamiento en la herencia de los caracteres. 
-La técnica del fenotipado del ADN :a) Es una técnica forense b) Consiste en predecir los rasgos físicos de una persona sabiendo su ADN c) Sólo sirve para descartar sospechosos d) Todas.

                     

    



Otro docu sobre epigenética 53'

Cuestiones:
1-Cómo se llama a la genética que simplemente predice la transmisión de genes?
2-Cómo se llaman a los niños con síndrome de Engelman?
3-que tienen en común los síndromes de Prader-Bilig y de Engelman?
4-Cuál era el objetivo del Proyecto Genoma Humano?
5-Qué es la impronta genética?
6- Cómo se llama a la ciencia que estudia la activación y desactivación de los genes?
7-Podemos decir que las marcas epigenéticas se heredan, pon un ejemplo?
8-Cómo explicarías según  este documental porque tú generación en general es más alta que la de tus padres.

-¿Es lo mismo la nutrigenómica que la nutrigenética?: a) No,ya que mientras que la primera estudia la interacción de los nutrientes sobre el material genético la segunda estudia como ciertos genes propiciarán como tal o cual nutriente afecte a la salud de un individuo b) Sí , ya que genómica y genética son términos homólogos. c) Ninguna de las anteriores.



  Práctica de laboratorio: extracción del ADN.




Trabajo para subir nota:

Empleando la siguiente herramienta establece una línea del tiempo de la historia de la genética.

   Te puedes ayudar con 🙏


SECCIÓN CURIOSIDADES

El coywolf es un híbrido entre coyote, lobo y perro.
SECCIÓN PERSONAJES

Alec Jeffreys,descubridor del ADN como prueba forense.


Hugo de Vries

Si aún no has visto la película gattaca

SECCIÓN VIDA DE PELÍCULA



No hay comentarios:

Publicar un comentario