sábado, 23 de mayo de 2015

CULTURA CIENTÍFICA 1º BACHILLERATO



       





      Cultura científica de 1º de bachillerato


PRIMERO RECORDEMOS  ALGUN INSTRUMENTO DE EVALUACIÓN:

           Los exámenes escritos tienen un tiempo máximo de duración, el cual es individual, es decir cada alumno tiene el suyo propio determinado a partir del resto de instrumentos.
Por  ejemplo una tarea sin hacer impuntualidad o ausencia injustificada restará de 5' a 10' de examen dependiendo de la “falta”.


Prezi presentación de la materia

Bloque 1. Procedimientos de trabajo


Criterios de evaluación

1. Obtener,  seleccionar  y  valorar  informaciones  relacionadas  con  la  ciencia  y  la  tecnología  a
partir de distintas fuentes de información.
2. Valorar la importancia que tiene la investigación y el desarrollo tecnológico en la actividad
cotidiana.
3.  Comunicar  conclusiones  e  ideas  en  soportes  públicos  diversos,  utilizando  eficazmente  las
tecnologías de la información y comunicación para transmitir opiniones propias argumentadas.
Estándares de aprendizaje evaluables
1.1. Analiza un texto científico o una fuente científico-gráfica, valorando de forma crítica, tanto
su rigor y fiabilidad, como su contenido.
1.2.  Busca,  analiza,  selecciona,  contrasta,  redacta  y  presenta  información  sobre  un  tema
relacionado  con  la  ciencia  y  la  tecnología,  utilizando  tanto  los  soportes  tradicionales  como
Internet.
2.1. Analiza el papel que la investigación científica tiene como motor de nuestra sociedad y su
importancia a lo largo de la historia.
3.1.  Realiza  comentarios  analíticos  de  artículos  divulgativos  relacionados  con  la  ciencia  y  la
tecnología,  valorando  críticamente  el  impacto  en  la  sociedad  de  los  textos  y/o  fuentes
científico-gráficas analizadas y defiende en público sus conclusiones.


Resultado de imagen de cajalResultado de imagen de hipatia de AlejandríaResultado de imagen de severo Ochoa

Trabajar las competencias clave:
Para  encuentra en las siguientes imágenes el gazapo.
CL,
external image cientificos.gif?w=300&h=298
Test diagnóstico
¿Qué sabeis de ciencias?(T)

1 Nombra cuatro científicos, dos hombres y dos mujeres, indicando algunas de sus aportaciones.
 Uno de ellos ha de ser aragonés.
2 Indica quién inventó o descubrió: a) El primer lenguaje de programación de ordenador. b) La bombilla o lámpara de incandescencia. c) El teléfono. d) La penicilina.
3 Indica el nombre de los científicos que escribieron los siguientes libros: a) La revolución de las órbitas celestes b) Los diálogos sobre los dos sistemas del mundo c) Principios matemáticos de Filosofía natural d) El origen de las especies por selección natural e) La deriva continental 4¿Hace cuánto tiempo se formó el Universo?5¿Cuál de ellos está más lejos del Sol? a) Venus b) La Tierra 6¿Qué es un año luz y cuál es su valor en el Sistema Internacional?7 Explica por qué es una hora menos en Canarias que en Madrid.8 ¿Qué teoría explica globalmente la formación de la Tierra y su dinámica, así como los diferentes fenómenos geológicos? 9¿En qué consiste la teoría de la generación espontánea?10¿Qué diferencia fundamental hay entre las teorías fijistas y evolucionistas?11Indica el “microorganismo” responsable de las siguientes enfermedades: a) tuberculosis b) malaria o paludismo c) SIDA 12 ¿En qué consiste la clonación? 13 ¿Qué son los alimentos transgénicos? 14¿Qué son los Objetivos del Milenio?15 ¿Cuál fue el recurso o tema monográfico de la Exposición Universal de Zaragoza 2008? 16 ¿Cuál es la principal causa del actual cambio climático global? 17 ¿En qué consiste la nanotecnología? 18 ¿Qué diferencia hay entre bits y bytes? 19 Un kilobyte, ¿a cuántos bytes equivale? 20 Indica el nombre genérico de los programas que sirven para conectarse a Internet y especifica el nombre de alguno de ellos.● ¿Qué son los organismos transgénicos?○ Organismos que contienen genes y, por tanto, son rechazados por los ecologistas○ Organismos más baratos que los tradicionales. Por ello los ecologistas están a favor de su producción.○ Bacterias que provocan infecciones graves en los seres vivos.○ Organismos a los cuales se les ha introducido en su material genético uno o más genes de otro ser vivo.● La molécula que induce la formación de anticuerpos se llama :a) Leucocito b) Linfocito .c) Antígeno.● Una de las siguientes afirmaciones NO es correcta, ¿cuál?○ Los combustibles fósiles son el carbón, el petróleo y el gas natural.○ Como consecuencia del calentamiento global, enfermedades y especies se desplazarán hacia el ecuador.○ El dióxido de carbono es un gas que contribuye al efecto invernadero.○ La actividad solar no es la principal causa del calentamiento global.● Ordena de mayor a menor tamaño:○ Célula ○ Átomo ○ Microchip ● La teoría de la selección natural explica:○ El origen de la vida.○ El origen común de todos los seres vivos.○ La evolución lenta y gradual de las especies.○ La evolución del Universo.● Señala la respuesta correcta: si la probabilidad de que llueva el sábado es del 50% y la de que llueva el domingo también del 50% entonces:○ La probabilidad de que llueva el fin de semana es del 100%.○ La probabilidad de que llueva el fin de semana es del 50%○ No lloverá el fin de semana ○ Llueve seguro el fin de semana.Qué es un byte.Es una unidad de información utilizada por las computadoras. Es una unidad de medida para calibrar la información en Internet. Es un tipo de datos de almacenamiento.  ¿A qué tipo de periférico corresponde un CD-ROM?:A tecnología de papel. A tecnología magnética .A tecnología óptica . La molécula que almacena la información genética es:○ El ARN○ El ADN○ La proteínas .¿Qué parte de la Tierra se encuentra en estado líquido? Ninguna .Toda la Tierra es sólida. El Manto, pues los continentes flotan en él. Todo el Núcleo, debido a la temperatura que posee. Sólo el Núcleo Externo . ¿Qué es el Big Bang?○ La explosión de una supernova ○ Una explosión nuclear controlada ○ El estado inicial que dio lugar al universo observable.○ Una gran banda de música . Los aparatos de TV y los monitores de las computadoras:○ no emiten radiación y por tanto no perjudican a los seres humanos ○ emiten radiación y no perjudican ○ sí emiten radiación, esta es perjudicial dependiendo del tiempo y la distancia al monitor. La radiación ultravioleta emitida por el Sol○ Parte es necesaria y parte perjudicial para la vida.○ Es perjudicial para todos los seres vivos.○ Necesaria sólo para algunos seres vivos. Cuál de los siguientes personajes no está asociado a la ciencia ○ Santiago Ramón y Cajal ○ Vicente Aleixandre ○ Nicolás Copérnico.
¿Qué son los fósiles?○ Tibios reflejos de seres ancestrales.○ Restos óseos sólo con interés mediático.○ Piezas fraudulentas para demostrar lo que se quiere.○ El único testimonio directo de parte de la apariencia física de un ser vivo 
¿Cuál de estas afirmaciones es cierta?○ Los clones humanos por compartir el mismo genoma, son idénticos físicamente y en su comportamiento.○ Los clones humanos aunque compartan el mismo genoma no tienen por qué ser físicamente idénticos o en su comportamiento.○ Los clones humanos aunque compartan el mismo genoma son necesariamente físicamente idénticos pero no en su comportamiento.○ Los clones humanos no existen todavía.

 Relaciona cada nombre con una disciplina científica1) Marie Curie A) Física2) Isaac Newton B) Relatividad3) Albert Einstein C) Radioactividad4) Charles Darwin D) Evolución de las especies  ¿Cuál de los siguientes casos astronómicos sería una amenaza real para la Tierra?○ Una conjunción entre Marte, Saturno y la Luna en Sagitario.○ Una explosión de supernova en la galaxia de Andrómeda.○ Un asteroide cercano cuya órbita no se conoce muy bien.○ Un eclipse de Sol que atravesara las zonas más pobladas de Europa y Asia . ¿Cuál es el principal problema de los residuos radiactivos ?a)La manipulación b)La obtención c)  El almacenamiento d)Los procesos de explotación  ¿Qué son los materiales textiles? A. Todos aquellos materiales que están formados por fibras .B. todos aquellos materiales que están formados por vegetales .C. son materiales de ingeniería hechos a partir de dos o más componentes El primer naturalista que desarrolló una teoría de la evolución fue :A – Lamarck .B – Darwin .C– Miller
Tarea 1 Para todos.


   Busca información (unas 3 líneas ) sobre la situación de la investigación científica en españa(compararla con la de otros países del entorno en cuanto a presupuesto,sueldos,calidad...)


Tarea 2 (S)

CSC,CEC
-Buscar información de científicos que dan nombre a nuestras calles. Preparar una biografía resumida con una línea del tiempo. Buscar y seleccionar sus investigaciones, sus obras y la importancia de sus estudios y elaborar un informe en Google Docs.(S) Ej. Avenida Sanz Gadea( médico)


Tarea 3(S)

Discurso pronunciado por el físico británico Stephen Hawking Premio Príncipe de Asturias de la Concordia 1989
Actitudes públicas ante la Ciencia y la Tecnología

CSC,CMCT

   Me gustaría decir algunas palabras sobre la consciencia y actitudes públicas ante la ciencia y la tecnología. Nos guste o no, el mundo en que vivimos ha cambiado mucho en el último siglo, y, probablemente, cambiará aún más en los próximos cien años.
 Si admitimos que no es posible impedir que la ciencia y la tecnología cambien el mundo, podemos al menos intentar que esos cambios se realicen en la dirección correcta. En una sociedad democrática, esto significa que los ciudadanos necesitan tener unos conocimientos básicos de las cuestiones científicas, de modo que puedan tomar decisiones informadas y no depender únicamente de los expertos. 
¿Qué se puede hacer para aprovechar ese interés y dar a los ciudadanos la educación científica que necesitan para tomar decisiones informadas en temas como la "lluvia ácida", el "efecto invernadero", las armas nucleares o la ingeniería genética? Claramente, la base debe estar en lo que se enseña en los colegios.
  Científicos e ingenieros tienden a expresar sus ideas en forma de ecuaciones, porque necesitan conocer los valores exactos de las cantidades. Pero para otras personas una comprensión sustancial de los conceptos científicos es suficiente. Y esto puede expresarse mediante palabras y diagramas, sin el uso de ecuaciones complejas.
   La ciencia que la gente aprende en los colegios puede proporcionarnos un marco básico. Pero el ritmo del progreso científico es ahora tan rápido, que siempre hay nuevos avances que han surgido después de que uno ha dejado la escuela o la universidad. 

   Libros  y  revistas sobre ciencia pueden ayudar a conocer nuevos avances. Pero incluso el más exitoso libro de divulgación es leído sólo por una pequeña parte de la población. Únicamente la televisión puede conseguir una audiencia masiva. Los productores de programas científicos para la televisión deberían comprender que tienen la responsabilidad de educar al público, y no solamente de entretenerlo.




Actividades:

A1. El discurso de Hawking trata de convencernos de la importancia de conocer la Ciencia para todos los ciudadanos, incluso las personas que no han estudiado nunca las materias de Ciencias. Indica cinco temas de interés en la actualidad en los qué, en tu opinión, todos los ciudadanos que deberíamos ser capaces de tomar decisiones por nosotros mismos.


A2. ¿Crees que la ciencia ha mejorado nuestra calidad de vida? Sopesa e indica aspectos positivos y algunas limitaciones de la Ciencia y la Tecnología.


A3. Comenta la siguiente frase del texto: “En una sociedad democrática los ciudadanos necesitan tener unos conocimientos básicos de las cuestiones científicas, de modo que puedan tomar decisiones informadas y no depender únicamente de los “expertos”:


A4. Indica, a tu juicio, cuáles son los seis avances científicos más importantes que se han producido en las últimas décadas.

A6. Indica cuáles son los problemas más importantes de la actualidad, a los que la ciencia y los científicos deberían dar solución. Elabora una lista individualmente y luego compárala con la que han elaborado los compañeros de tu grupo y complétala para hacer una puesta en común entre toda la clase.


Tarea 4

 CIENCIAS & PSEUDOCIENCIAS.


CEC,CSC


1. Busca información sobre el significado de ambos conceptos y expón alguna diferencia que puedas entender su significado.

2.Vídeo(6')

1-¿De que hablan?
2-¿Te resulta familiar?
3-¿Crees que se trata de ciencia o pseudociencia?
4-¿Crees que este documental cambiaría tu afición a los horóscopos?¿Por qué?



Tarea 5

 El lado oscuro de la ciencia.


CEC,CSC,CMCT


Aunque es evidente que debemos poner sobre la mesa las carencias y contradicciones en la que incurren con frecuencia las pseudociencias, propiciando de esta forma una reflexión crítica ,no es menos cierto que, desgraciadamente en más de una ocasión, la “ciencia oficial” se mueve por intereses socioeconómicos imperantes en cada momento y en cada lugar. El siguiente enlace es un ejemplo de esto:



● Información en el NODO(años 70) de la existencia de vida en Marte.

○ http://www.youtube.com/watch?v=NsEB_mIttVk.



   Aunque quizás..
    TAREA 6

    CEC,CSC,CMCT



    ● LOS IG NOBEL


    En el mundo de la ciencia y la investigación, no todo es cara seria y poca diversión. De hecho todo lo contrario, ya que existen personas que, en dichos ámbitos de trabajo, logran encontrarle el lado divertido y casi humorístico, descubriendo así cosas de la vida cotidiana de las cuales no teníamos idea anteriormente. 
      Como si fuera poco, estos investigadores son premiados con el Ig Nobel.Los premios reciben el nombre en recuerdo a Ignatius, hermano ficticio de Alfred Nobel, y auténticos premios Nobel se encargan de entregarlos.

    Este año un español ha sido agraciado por descubrir que los caballos blancos, gracias a la polarización de la luz, son menos propensos a las picaduras de los tábanos.... El mismo motivo hace que las libélulas se sientan fatalmente atraídas por las lápidas negras.

       Así tambien un grupo de investigadores alemanes ha descubierto que si te pica el lado izquierdo del cuerpo, puedes aliviarte mirándote al espejo y rascándote el lado derecho del cuerpo. Y viceversa. ¿A que nunca lo habías probado?
    • -Busca en la red más información sobre los Ig Nóbel,escoge el que más te llame la atención y propón una investigación que presentarías a dichos premios.



    TAREA 7 La ciencia y el método científico

    • CMCT,CL
    • 0-Pon un ejemplo de conocimiento que te han enseñado y de otro que has aprendido por experiencia propia.
    • 1-Cómo definirías tú el concepto de Ciencia.
    • 2-Crees que hay algún concepto/s(palabra)que podría ser su antónimo?
    • 3-Escribe todas las palabras que conozcas que tengan el sufijo “logía”(ej geología).
    •   Elige el visionado de uno de los siguientes vídeos :

    -¿Cuál elegiste? ¿Por qué?
    -¿Podrías definir" método científico"?
    • 4-La gnoseología (del griego γνωσις, gnosis, "conocimiento" o "facultad de conocer", y λόγος, )es una rama de la filosofía que estudia la naturaleza, el origen y el alcance del conocimiento.
    • 5-Aprovecha estos “epistemes o gnosis” y escribe en griego la palabra “gos” que en catalán significa perro. Serías capaz de escribir “soga”?

    • Tarea 7

    • CIENTÍFICO HASTA EN LA MUERTE.
    • Resultado de imagen de guillotina gif
    • CSC,
    • Antoine-laurent de lavoisier, 1743-1794 Químico francés perteneciente a la rica aristocracia de toga (familia de abogados y parlamentarios), nació el 26 de agosto de 1743 y murióguillotinado el 8 de mayo de 1794 en París. Fue el primer científico que enunció la primera versión de la "Ley de Conservación de la Materia", identificó y bautizó el oxígeno (en 1778) y participó a la reforma de la nomenclatura química. Siendo también uno de los 28 "Fermiers Généraux" (recaudadores de impuestos), Lavoisier fue estigmatizado como un traidor por los revolucionarios en 1794, y condenado a morir en la guillotina durante el Terror, en París el 8 de mayo de 1794. Cuando Lavoisier fue procesado, el juez, que se disponía a expedirle el pasaporte para la guillotina, soltó con sequedad: "La República no necesita a sabios! La Justicia debe seguir su curso!".   Lavoisier pidió a sus amigos que cuando cayera su cabeza observaran atentamente sus ojos para saber cuanto tiempo permanecía viva una persona después de decapitada. Así lo hicieron y constataron que parpadeó durante 15 segundos.
    • 1-Has pensado por qué escoges unas materias y no otras en el instituto.
    • 2-Cuáles crees son los motivos que una persona tiene para estudiar ciencias, y  para ser científico?
    • Es un conjunto de enunciados acerca de algo, que se ordenan en un sistema.(ej leyes de Newton,Mendel…)
    • Se elabora de acuerdo con un método específico: el método científico.(Observamos,hipotetizamos,experimentamos y concluimos)
    • Elabora conocimientos que han de ser contrastables (debe haber algún modo de comprobar si lo que afirman sus enunciados es verdadero o falso,p.ej para demostrar laley de la gravedad soltar un objeto…).
    • Es un proceso dinámico y siempre en revisión.(p.ej del geocentrismo al universo en expansión pasando por el heliocentrismo)



    Bloque 2. La Tierra y la vida



    Criterios de evaluación

    1. Justificar la teoría de la deriva continental en función de las evidencias experimentales que
    la apoyan.
    2. Explicar la tectónica de placas y los fenómenos a que da lugar.
    3.  Determinar  las  consecuencias  del  estudio  de  la  propagación  de  las  ondas  sísmicas  P  y  S,
    respecto de las capas internas de la Tierra.
    4. Enunciar las diferentes teorías científicas que explican el origen de la vida en la Tierra.
    5.  Establecer  las  pruebas  que  apoyan  la  teoría  de  la  selección  natural  de  Darwin  y  utilizarla
    para explicar la evolución de los seres vivos en la Tierra.
    6. Reconocer la evolución desde los primeros homínidos hasta el hombre actual y establecer
    las adaptaciones que nos han hecho evolucionar.
    7. Conocer los últimos avances científicos en el estudio de la vida en la Tierra.
    Estándares de aprendizaje evaluables
    1.1.  Justifica  la  teoría  de  la  deriva  continental  a  partir  de  las  pruebas  geográficas,
    paleontológicas, geológicas y paleoclimáticas.
    2.1. Utiliza la tectónica de placas para explicar la expansión del  fondo oceánico y la actividad
    sísmica y volcánica en los bordes de las placas.
    3.1.  Relaciona  la  existencia  de  diferentes  capas  terrestres  con  la  propagación  de  las  ondas
    sísmicas a través de ellas.
    4.1. Conoce y explica las diferentes teorías acerca del origen de la vida en la Tierra.
    5.1. Describe las pruebas biológicas, paleontológicas y moleculares que apoyan la teoría de la
    evolución de las especies.
    5.2. Enfrenta las teorías de Darwin y Lamarck para explicar la selección natural.3
    6.1. Establece las diferentes etapas evolutivas de los homínidos hasta llegar al Homo sapiens,
    estableciendo sus características fundamentales, tales como capacidad craneal y altura.
    6.2. Valora de forma crítica, las informaciones asociadas al universo, la Tierra y al origen de las
    especies, distinguiendo entre información científica real, opinión e ideología.
    7.1.  Describe  las  últimas  investigaciones  científicas  en  torno  al  conocimiento  del  origen y
    desarrollo de la vida en la Tierra.
    Señala la respuesta correcta:
    Teoría

    TEST 

    1.Señala la correcta: Las ondas S no se transmiten por los líquidos. Las ondas P son las más rápidas. Las ondas superficiales son muy destructivas. Todas son correctas.

     2. ¿Qué parte de la Tierra se encuentra en estado líquido?:Ninguna. Toda la Tierra es sólida. El Manto, pues los continentes flotan en él. Todo el Núcleo, debido a la temperatura que posee. Sólo el Núcleo Externo.

    3. ¿Dónde se encuentra la Astenosfera?Justo bajo la Corteza.Es una parte del Manto. Se corresponde con el Núcleo Externo. En ningún sitio. No existe.
    4. En general, ¿qué parte de la Corteza es más antigua?La Oceánica. La Continental. Son, más o menos, de la misma edad. No se puede llegar a saber con exactitud. 
    5. Y ¿cuál es más heterogénea?:La Oceánica. La Continental. Son similares. Depende de la región geológica a que nos refiramos.
     6. ¿Cuál es más gruesa?:La Oceánica. La Continental. Son aproximadamente del mismo grosor. En unas zonas la Oceánica y en otras la Continental.
    7. ¿En qué capa se origina el campo magnético terrestre?:Justo bajo la Corteza. En una parte del Manto. En el Núcleo. En la Astenosfera.
     8. Las peridotitas son:Un tipo de rocas que son similares a las de Manto superior. Un tipo de meteoritos. Unas rocas que aparecen en la corteza oceánica. Unas islas formadas por volcanes.
    10. La convección es:Un tipo de transmisión de calor con movimiento de materia. Un tipo de transmisión de calor sin movimiento de materia. Un tipo de transmisión de calor por ondas sísmicas. Algo exclusivo del Manto terrestre.



    Práctica



    11. El motor interno terrestre funciona debido:A la radiación solar y sus mareas gravitacionales. A los elementos radiactivos acumulados en el Núcleo terrestre. Al calor interno del Manto. Al calor interno del Núcleo y a los elementos radiactivos del Manto. 
    12. Las corrientes convectivas del Manto se deben a:Disminución de volumen de las rocas con el aumento de temperatura. Aumentos en la densidad. Cambios en la densidad con la temperatura y la acción de la gravedad. Disminución de densidad. 
    13. Una Pluma mantélica:Es una estructura de las peridotitas y las dunitas. Produce vulcanismo de punto caliente. Está producido por los puntos calientes de las peridotitas del Núcleo. Todo lo anterior es cierto.
    14. Una placa litosférica es:Corteza que se desliza sobre la astenosfera plástica. Porción del manto superior sobre la astenosfera rígida. Todo lo que existe sobre la astenosfera sólida. Porción de litosfera que es arrastrada por las corrientes de convección.
     15. En los límites divergentes:Se destruye corteza oceánica. Se juntan los continentes.Se produce la subdución. Crecen las placas que se encuentra a sus lados. 
    16. La etapa de Rift pertenece a :El proceso de colisión continental.Las dorsales.El proceso de ruptura continental. Todas las respuestas anteriores son correctas. 
    17. En la subducción: Se produce un intenso magmatismo y vulcanismo. Se produce una intensa sismicidad. Todas las respuestas son correctas.Se produce destrucción de litosfera oceánica.

    18. En la colisión continental:La litosfera de uno de los continentes subduce bajo la del otro. Se pueden encontrar ofiolitas obducidas.Se genera una gran cordillera volcánica. Todas las anteriores son ciertas. 
    19. Las zonas de fallas transformantes: Generan un intenso vulcanismo. Producen violentos terremotos.Hacen que dos placas se separen. Generan una gran sedimentación. 
    20. Los terremotos y el vulcanismo:Se asocian siempre a los límites de placa. Se asocian al interior de las placas. Se asocian a límites de placa, pero también se producen en su interior. Se producen sólo en las zonas de subdución.
    21. En el Ciclo de Wilson, la entrada de agua de mar e inicio de formación de litosfera oceánica se denomina:(a) Etapa de Rift(b) Etapa Pacífico(c) Etapa Himalaya(d) Etapa Mar Rojo.
    22. En el Ciclo de Wilson, el final de la subducción se denomina:(a) Etapa Atlántico(b) Etapa Golfo Pérsico(c) Etapa Mar Rojo(d) Etapa Hilmalaya.
    23. En el Ciclo de Wilson, el inicio de subducción se produce en la:(a) Etapa Golfo Pérsico(b) Etapa Pacífico(c) Etapa Mar Rojo(d) Etapa Atlántico.

    24.El científico de la fotografía, geofísico alemán, presentó una hipótesis movilista: "La Deriva Continental". ¿Quién es?
    Resultado de imagen de alfred wegener
    a)Shackleto.b)Mohorovici.c)Wegener.d) Gutenberg,

    24'.Para la teoría de la Deriva Continental la existencia de fósiles del reptil Mesosaurus en Sudafrica y Sudamérica es una prueba .... paleoclimática, paleontológica, geográfica,geológica,
    Resultado de imagen de mesosaurus gif
    25. Los límites convergentes en arcos insulares se caracterizan por:(a) Litosfera oceánica subduce bajo litosfera continental(b) Litosfera continental subduce bajo litosfera oceánica(c) Litosfera continental subduce bajo litosfera continental(d) Colisión continental.
    26. Los límites transformantes se encuentran:(a) Asociados a límites convergentes(b) Grandes Orógenos, fosas oceánicas(c) Uniendo tramos de dorsal y deslizando 2 placas(d) En San Francisco
    27. Los límites transformantes se caracterizan por:(a) Vulcanismo y sismicidad(b) Sólo sismicidad(c) Sólo vulcanismo(d) Carecen de sismicidad ni vulcanismo
    28. Japón se encuentra en:(a) Límite convergente(b) Límite transformante(c) Límite divergente(d) Japón no se encuentra en un límite de Placa.
    29. El sur de la península ibérica se encuentra en:(a) Límite convergente(b) Límite transformante(c) Límite divergente(d)El sur de la penísua ibérica  no se encuentra en un límite de Placa.

    30. Islandia se encuentra en:(a) Límite convergente(b) Límite transformante(c) Límite divergente(d) Islandia no se encuentra en un límite de Placa
    31. Los límites convergentes coinciden geográficamente con:(a) Grandes cadenas marginales como los Andes(b) Fosas oceánicas(c) Arcos insulares(d) Coinciden con los tres anteriores.

    32. Los límites divergentes se caracterizan por:(a) Que los continentes se separan produciendo terremotos(b) Los placas se aproximan(c) Se separan dos placas permitiendo el ascenso de magmas(d) Que las placas rozan lateralmente produciendo terremotos.
    33. Los limites divergentes coinciden geográficamente con:(a) Fosas Oceánicas(b) Grandes Orógenos(c) Dorsales Oceánicas(d) Grandes fallas lineales
    34. Característico de los límites divergentes es:(a) Vulcanismo y sismicidad(b) Sólo sismicidad(c) Sólo vulcanismo(d) Carecen de sismicidad y vulcanismo.

    35. Los límites convergentes se caracterizan por:(a) Vulcanismo y sismicidad(b) Sólo sismicidad(c) Sólo vulcanismo(d) Carecen de sismicidad y vulcanismo.


    Test 

    ORIGEN DE LA VIDA Y   EVOLUCIÓN






    1-La visión que tenemos sobre la Ciencia puede ser:A-Determinista (ante mismas condiciones iniciales,mismas consecuecias.El mundo está lleno de regularidades) y B-probabilista o indeterminista(…no mismas consecuencias.Singularidades).

       Actividad:Debate

    El destino, una de las formas más populares de determinismo.

    ¿Eres de los que crees en el destino, o simplemente no crees en prácticamente nada?

      Para ello formaremos dos grupos de clase, unos a favor y otros en contra de la creencia en el destino:
    Os dejo un enlace relacionado con el tema:

    Debate en la red



    2-Los fijistas creían que todas las especies fueron creadas al principio de los tiempos:Verdadero.Falso.

    -En esta lista hay un famoso científico fijista:
    a) Cuvier;
    b) Lamarck;
    c) Jean Baptiste Monet;
    d) Darwin.


     Vídeo sobre el origen de la vida


    3-El meteorito que cayó en Australia en 1969 y que contenía muchos compuestos orgánicos se llamaA-Siderito.B-Murchinson. C-Halley.D-Hyakutake.
    4-La demostración experimental de la síntesis abiogénica de materia orgánica se debe aA-Pasteur. B – Needhan.C – Miller y Urey.D – Orgel.
     
    5-La demostración experimental de la síntesis abiogénica de bases nitrogenadas,azúcares y lipidos se debe a:A-Joan d’Oro. B – Needhan.C – Miller y Urey.D – Orgel..
    6-El nombre de uno de los científicos que proponen el origen extraterrestre de la vida-migracionismo o panspermia- es A-Joan d’Oro. B – Needhan.C – Miller y Urey.D – Orgel.
    7- A qué científico se debe el concepto de sopa primitiva? A - F. Redi.B – Pasteur.C – Darwin.D – Oparín.E – Mendel.
     
    8-Las “gotas” de biomoléculas existentes en la sopa primitiva se llaman coacervados Verdadero.Falso.
    9-Pasteur demostró que la teoría de la generación espontánea era falsa:Verdadero. Falso.


    El homúnculo o crear vida en la cocina.


    -El primer naturalista que desarrolló una teoría de la evolución fue: A – Lamarck. B - Darwin.C - Miller.D - Oparin.E – Pasteur.
    Azara Félix de 1746-1821.jpg
    Se planteó la posibilidad de la evolución de las especies, preguntándose las similitudes existentes ante la falta de rigor científico, antes que el propio Charles Darwin, quien conocía sus estudios.

    Félix de AzaraFrancisco de Goya. (Museo Camón Aznar de Zaragoza).
    Nacimiento18 de mayo de 1746
    BarbastroEspaña
    Fallecimiento20 de octubre de 1821
    HuescaEspaña
    NacionalidadEspañola
    OcupaciónBotánico y geógrafo
    10-Según Lamarck los caracteres adquiridos se heredan Verdadero.Falso.
    -Según Darwin la función crea el órgano VerdaderoFalso.
    11-Según Darwin el principal mecanismo de evolución es la selección natural. Verdadero.Falso.








    12-Una de las ideas básicas del lamarkismo es:A - La variabilidad de la descendencia.B - La función crea el órgano.C - La selección natural.D - La especiación.
     
    13-El neodarwinismo también se llama teoría sintética y se fundamenta en los mecanismos evolutivos de la selección natural y las mutaciones Verdadero.Falso.
    14-El neodarwinismo nació de aplicar los postulados de Lamarck y de Darwin Verdadero.Falso.

    15-El saltacionismo (o equilibrio punteado) y la teoría evo-devo son dos teorías sobre la evolución. Verdadero.Falso.
    16-El creacionismo y  la “teoría” del diseño inteligente  son posturas que creen en el hecho de la evolución. Verdadero.Falso.

    -Las teorías evolucionistas son...
    a) fijistas;
    b) creacionistas;
    c) transformistas;
    d) todas lamarckistas.

    17-Órganos homólogos son aquellos que:A - Tienen estructuras internas muy distintas pero desarrollan la misma función.B - Tienen la misma estructura interna pero pueden estar adaptados a funciones muy diferentes.C - Indican que ante un mismo problema de adaptación al medio, seres vivos muy diferentes responden con soluciones parecidas.D - Dan idea de una evolución convergente.
    PRUEBAS DE LA EVOLUCIÓN

    Ordena cronológicamente los ascendientes del caballo.

    18-La aleta de una ballena y el ala de un ave son órganos homólogos Verdadero.Falso.
    19-Las alas de las aves y las de los murciélagos son órganos homólogos Verdadero.Falso.
    20-Se llaman órganos vestigiales a aquellos órganos homólogos que no desarrollan ninguna funciónVerdaderoFalso.

     
     -Las aletas de una ballena y el brazo de un hombre son un ejemplo de...
    a) evolución convergente;
    b) órganos homólogos;
    c) órganos análogos;
    d) prueba paleontológica.

     -El tiburón y el delfín son animales que pertenecen a grupos muy diferentes, pez y mamífero respectivamente, pero su forma es muy similar. Esto es un ejemplo de...
    a) analogía;
    b) homología;
    c) serie filogenética;
    d) de formas intermedias.
     
     -Una importante prueba anatómica del hecho evolutivo es la evolución del aparato circulatorio de los vertebrados. Esto se demuestra porque la mayor complejidad del aparato circulatorio se da en...
    a) los peces;
    b) los anfibios;
    c) los reptiles;
    d) las aves y los mamíferos.

    - La siguiente afirmación: " Los topos, al vivir bajo tierra, en la oscuridad, se han adaptado perdiendo los ojos"  es una afirmación...
    a) típicamente darwinista, pues es lo que ha sucedido en la realidad;
    b) típicamente lamarckista pues se basa en la evolución según el uso y el desuso;
    c) típicamente neodarwinista pues se basa en las mutaciones.
    d) Ninguna de las afirmaciones anteriores es correcta.

    -Los osos polares son blancos. ¿Cómo se puede explicar este hecho según las teorías  darwinistas?
    a) Los osos se han vuelto blancos para confundirse con la nieve del medio en el que viven.
    b) En la nieve, los osos blancos están mejor adaptados y dejan más descendientes que los de pelo de otro color.
    c) Las mutaciones hacen que en la nieve los osos sean blancos y no de otro color.
    d) Ninguna de las afirmaciones anteriores es la correcta.

    -La siguiente afirmación: " los piojos, al ser parásitos, se les han atrofiado las alas " es una afirmación...
    a) típicamente Darwinista, pues es lo que ha sucedido en la realidad;
    b) típicamente Lamarckista pues se basa en la evolución según el uso y el desuso;
    c) típicamente neodarwinista pues se basa en las mutaciones.
    d) Ninguna de las afirmaciones anteriores es correcta.

     -Uno de estos principios es característico del darwinismo:
    a) La teoría del uso y del desuso;
    b) la herencia de los caracteres adquiridos;
    c) la evolución por selección natural;
    d) que la variabilidad se origina por mutación.

    - Los osos polares son blancos. ¿Cómo se puede explicar este hecho según las teorías  lamarckistas?
    a) Los osos se han vuelto blancos para confundirse con la nieve del medio en el que viven.
    b) En la nieve, los osos blancos están mejor adaptados y dejan más descendientes que los de pelo de otro color.
    c) Las mutaciones hacen que en la nieve los osos sean blancos y no de otro color.
    d) Ninguna de las afirmaciones anteriores es la correcta.

    -La figura  muestra cómo pudieron evolucionar las serpientes a partir de reptiles con patas. Indica cuál sería la interpretación neodarwinista.
    a) En un principio habría reptiles con las patas más cortas y más largas. Algunos reptiles sin patas estaban mejor adaptados dejaron más descendientes y dieron lugar a las serpientes actuales.
    b) Pudieron aparecer por mutación reptiles sin patas a partir de reptiles con patas. Algunos reptiles sin patas pudieron, en ciertas condiciones, estar mejor adaptados y dejar más descendientes, dando lugar a las serpientes actuales.
    c) Los lagartos son reptiles que se arrastran por el suelo. A algunos grupos de lagartos les desaparecieron las patas al emplearlas cada vez menos. Este carácter lo heredaron sus descendientes.

    d) Ninguna de las tres es la interpretación neodarwinista
     -Basándote en la pregunta anterior. Indica cuál sería la interpretación darwinista.

    - Basándote en las preguntas anteriores. Indica cuál sería la interpretación lamarckista.

     -¿Por qué en los pequeños islotes expuestos a los vientos es frecuente que los insectos no tengan alas? Indica la interpretación neodarwinista.
    a) Inicialmente llegan a los islotes insectos con alas normales. Ahora bien, por mutación pueden aparecer insectos no alados. Los insectos con alas están peor adaptados en los islotes y dejan menos descendientes. Los insectos sin alas al estar mejor adaptados dejan más. Cada vez habrá más insectos sin alas.
    b) Los insectos de los islotes dejan de volar para que el viento no los arrastre y poco a poco las alas se les atrofian
    c) Inicialmente llegan a los islotes insectos con alas y sin alas. Los insectos con alas son arrastrados por el viento y no dejan descendientes. Los insectos sin alas no son arrastrados. Cada vez habrá más insectos sin alas
    d) Ninguna de las tres es la interpretación neodarwinista
      
    EVOLUCIÓN HUMANA



    - Los antecesores de la especie humana se separaron del tronco común que luego dio lugar al gorila y al chimpancé hace...
    a) más de 50 m.a.
    b) más de 30 m.a.
    c) más de 20 m.a.
    d) entre 5 y 10 m.a


    -Dió lugar a todos los homínidos
     a)   Ardipithecus ramidus
     b)   Australopithecus anamensis
     c)    Paranthropus boisei
     d)    Homo habilis

    21-El género Australopithecus(3.7 m.a.) pertenece a la familia de los homínidos Verdadero.Falso.
    Huesos de Kadanuumuu y Lucy respectivamente,el 1º esmás antiguo.

    -El paleontólogo y año sobre el descubrimiento de Lucy: a) Cuvier 1800 b) Stephen Jay Gould 1980 c) Donald Johanson 1974 d)Mary Anning 1830
    2-La familia de los homínidos presenta únicamente el género Homo Verdadero.Falso.

    -¿Cuándo salieron los primeros homínidos de África?
    a) Hace 5 millones de años
    b) hace 3,7 millones de años
    c) hace 2 millón de años.
    d) hace 100.000 años

    23-Los fósiles más antiguos de Australopithecus encontrados pertenecen a la especie.A - A. anamensis.B - A. africanus.C - A. afarensis.D - A. robustus.

    24-A partir del Homo ergaster en África se evolucionó hacia el Homo antecessor:Verdadero Falso.
    -Primer homínido en aprovechar el fuego
    a)   Homo habilis
    b)   Homo erectus
    c)   Homo antecessor
    d)   Homo ergaster

    -Descubierto en Atapuerca
    a)   Homo habilis
    b)   Homo antecessor
    c)   Homo sapiens
    d)   Ardipithecus ramidus
    25-Homo antecessor es anterior a H. Erectus  y H. Heidelbergensis: Verdadero Falso.

    - El Homo erectus apareció hace:
    a) más de 10 m.a.;
    b) hace 3,7 m.a.;
    c) hace 1,8 m.a.
    d) hace 100.000 años.

    26-¿A qué especie se le llama hombre de Cromagnon? A - Homo sapiens neanderthalensisB - Homo sapiens sapiens.C - Homo heidelbergensis.D - Homo erectus.

    27-El hombre de neanderthal presentaba una capacidad de supervivencia mayor que la del hombre de Cromagnon Verdadero.Falso.

    28-La especie humana pertenece al orden de los primates Verdadero.Falso.

    29-No es una característica que compartamos con los primates:A-Pulgar oponible.B-Visión estereoscópica.C-Cinco dedos.D-Bipedismo.E-Sociabilidad.F-Fórmula dental.

    - ¿Cuál de los esqueletos de la figura  corresponde al hombre actual?
    a) el a
    b) el b;
    c) el c.
    d) Ninguno de los tres.
    Reconstruyendo esqueletos.

    30-El proceso evolutivo que conduce a la aparición de la especie humana se llama:A - Cranealización.B - Hominización.C - Prognatización.D – Racionalización.

    - ¿Cuál es el orden cronológico correcto, de mayor a menor antigüedad,  de los cráneos de la figura ?
    a) 2, 3, 4 y 1;
    b) 1, 2, 3 y 4;
    c) 4, 3, 1 y 2.
    d) 1, 3, 4 y 2;
    Relaciona cada cráneo con su dueño.

    31-La relación del tamaño de los dientes y el cuerpo nos da una idea de: A-Tipo de alimentación.B-Tipo de animal.C-Edad del animal.
    32 -Las líneas de Retzius sirven para estudiar: A-Tipo de alimentación.B-Tipo de animal.C-Edad del animal.


    33-La única manera de que se produzca especiación es que exista un aislamiento geográfico de la especie Verdadero.Falso.

    34-La biología molecular constituye el método más poderoso para reconstruir la historia evolutiva de los seres vivos Verdadero.Falso.
    35-La evolución es la transformación gradual y progresiva de organismos primitivos en otros más diferenciados y complejos Verdadero.Falso.
    36-Sobre las diferencias hereditarias causadas por las mutaciones actúa la selección natural Verdadero.Falso.
    37-Mediante selección natural se explican las distintas adaptaciones de los organismos a su medio ambienteVerdaderoFalso.
    38-Las mutaciones.A - Tienen siempre consecuencias catastróficas.B - Tienen como finalidad la adaptación de las poblaciones a su medio.C - Nunca se heredan.D - Son el origen de toda variación.


    Docu: Homo Sapiens. La odisea de la especie.


    El descubrimiento de la música por el ser humano.

    HISTORIA DE LA TIERRA Y LA VIDA EN DOS MINUTOS

    TRABAJEMOS LAS COMPETENCIAS




    Tarea 1
    CSC,CD,

       Conozcamos los.

    Un Premio Darwin es un premio irónico que toma su nombre del creador de la teoría de la evolución Charles Darwin. Se basa en el supuesto de que la humanidad mejora genéticamente cuando ciertas personas sufren accidentes, muertes o esterilizaciones por un error absurdo o un descuido

     Busca en la red ejemplos de estos premios.


      

      Y si crees que tus mayores son siempre  más sabios  que tú, desengáñate con los


    Stella Awards (Premios al ridículo legal)


    CAA,SIIE    
    Ricemos el rizo con las leyendas urbanas como por ejemplo:


    ¿Beber una cerveza con una pajita (cañita) emborracha más?



     Actividad:
    CSC,CEC,CMCT,CL
    -Visionado de la película La dudad de Darwin y contestación a una serie de cuestiones.


    SECCION GRANDES DOCUMENTALES

     Documental: Evolución.El juego de Dios.(52')










      SECCIÓN XAVIRADAS

    -Te crees mon@? En homenaje a Darwin mírate las orejas.


    Tubérculo de Darwin

    Práctica de laboratorio

    CMCT,CSC,CAA,SIIE

    1)Para aquellos que no vieron fósiles en 4º de la ESO.

    -Reconocimiento de fósiles-ejemplares proporcionados por el instituto,también por vosotros si teneis alguno y quereis intentar identificar.


    ¿Después de realizar la práctica eres capaz de reconocer los fósiles de la imagen?

    2) Para aquellos que sí los vieron pero no han hecho réplicas de fósiles.

    T: Construyendo fósiles.
    O: Adquirir destrezas y hábitos propios de un laboratorio de ciencias.
    M: Yeso,bol,plastilina,el resto los proporcionará el instituto.(15gryesox10mlH2O).

    3) Para los que han realizado ambas que sugieran otra relacionada con el bloque,pero planificada.

    Kahoot

    Bloque 3. Avances en biomedicina


    Criterios de evaluación

    1. Analizar la evolución histórica en la consideración y tratamiento de las enfermedades.
    2. Distinguir entre lo que es Medicina y lo que no lo es.
    3. Valorar las ventajas que plantea la realización de un trasplante y sus consecuencias.
    4. Tomar conciencia de la importancia de la investigación médicofarmacéutica.
    5. Hacer un uso responsable del sistema sanitario y de los medicamentos.
    6. Diferenciar  la  información  procedente  de  fuentes  científicas  de aquellas  que  proceden  de
    pseudociencias o que persiguen objetivos meramente comerciales.
    Estándares de aprendizaje evaluables
    1.1.  Conoce  la  evolución  histórica  de  los  métodos  de  diagnóstico  y  tratamiento  de  las
    enfermedades.
    2.1. Establece la existencia de alternativas a la medicina tradicional, valorando su fundamento
    científico y los riesgos que conllevan.
    3.1.  Propone  los  trasplantes  como  alternativa  en  el  tratamiento  de  ciertas  enfermedades,
    valorando sus ventajas e inconvenientes.
    4.1.  Describe  el  proceso  que  sigue  la  industria  farmacéutica  para  descubrir,  desarrollar,
    ensayar y comercializar los fármacos.
    5.1. Justifica la necesidad de hacer un uso racional de la sanidad y de los medicamentos.4
    6.1.  Discrimina  la  información  recibida  sobre  tratamientos  médicos  y  medicamentos  en
    función de la fuente consultada.

    Diagnosis inicial

    Contesta primero individualmente y realiza después una puesta en común en pequeño grupo de trabajo. 

    1.Indica qué es para ti la salud. Nombra dos palabras con que asocies el término salud. Forma una frase con el término
    salud y cada una de las palabras asociadas.
    2.¿Cuáles son las características de una vida sana o saludable?
    3._Explica qué significa que todos los seres humanos tenemos derecho a la salud e indica cómo se garantiza ese derecho. ¿Crees que se cumple en todas las partes del mundo? ¿Qué otros derechos fundamentales tienen las personas?
    4._Indica cuáles crees que son las necesidades básicas que todos los seres humanos deberían tener cubiertas. Colócalas por orden de prioridad o importancia: dinero, amor y salud.
    5._Cada vez vivimos más tiempo. ¿Crees qué vivimos cada vez mejor? ¿Qué es vivir bien?
     ¿Conoces los factores que dependen de cada uno de nosotros para estar sanos?
     ¿Cómo podríamos evitar las enfermedades crónicas?
    ¿Sabes cuál es la enfermedad responsable de la mayor epidemia actual?
     ¿Dónde crees que hay más microorganismos: en el teclado de un ordenador o en el baño?
     ¿Cómo debes actuar cuando te encuentres con malestar general, fiebre y vómitos?
    6. ¿Qué opinión tienes del dicho: «la gripe se cura en una semana con antibióticos y en siete días sin antibióticos»?
    7. ¿Has tomado medicamentos en alguna ocasión?
    8. ¿Sabes para qué servían?
    9. ¿Te informaste de sus características?
    10. ¿Sabes si en la farmacia te darían una aspirina sin receta? ¿Y un antibiótico?
    11. ¿Qué es un medicamento genérico?
    12. ¿Sabes en qué consiste el uso racional de los medicamentos?
    13. ¿Qué sabes y qué opinas de la donación de órganos?
    14. ¿Hay algún gran hospital cerca de tu casa?
    15. ¿Sabes cómo se llama? Indica su nombre?
    16. ¿Tienen las mismas condiciones de vida las personas que viven en un barrio residencial que las que habitan en una
    zona marginal de cualquier ciudad?
    17. ¿Padecerán las mismas enfermedades?
    18. ¿Quiénes tendrán una vida más saludable, las que viven en un barrio residencial o las del barrio marginal?
    _Explica por qué crees que es tan importante lavarse bien las manos con jabón antes de comer o después de ir al baño.
    _Explica qué son las enfermedades infecciosas y pon dos ejemplos de enfermedades infecciosas y dos de no infecciosas.
    _Explica qué son las enfermedades virales y pon ejemplos.
    _Indica algunas enfermedades asociadas a procesos degenerativos del cerebro.
    _Explica las diferencias entre antibióticos y vacunas.






     Tarea 1 A

    MEDICINA PERSONALIZADA


    En 1872 sacar una muela era uno de los mayores suplicios a los que se podía someter a una persona. En los años 30 y 40, se empleaban artilugios de madera para enderezar los huesos. Y las máscaras de gas, como las que se usaban en las trincheras, servían para tratar a los pacientes con asma. En la actualidad lo último de la medicina es la tecnología digital y a distancia. Robots cirujanos permiten operar desde cualquier rincón del planeta. Desde que conseguimos descifrar el Genoma Humano, hace diez años, la medicina aspira a transformarse radicalmente, a detectar las enfermedades antes de que aparezcan y a diseñar terapias según los genes de cada individuo. Es la medicina personalizada. Más centrada en garantizar la salud y el bienestar que en combatir las enfermedades. ¿Estamos ya cerca de ella? tres14 se lo pregunta a los oncólogos David Khayat y Carlos Caldas, que buscan nuevas formas de frenar la lacra del cáncer; al cardiólogo Ramón Brugada, que intenta resolver la muerte súbita en deportistas; al catedrático de farmacología Dan Roden, que investiga por qué no todos respondemos igual a un medicamento; y al cirujano Manuel Sánchez, que estudia cómo aumentar nuestra longevidad.

     Documental

    Preguntas:

    -¿Por qué crees que se hace la pregunta de si será rentable la medicina personalizada?
    -Pon dos ejemplos de patologías en las que los médicos prueban medicamentos con sus pacientes.
    -¿Cuál ha sido el "banco" de la medicina personalizada?
    -¿Cuál es el principal origen de la muerte súbita de 800.000 personas al año en los paises occidentales(superando a otro tipo de muerte como el cáncer o los accidentes)?
    -El 20% de los casos de muerte súbita tienen su origen en nuestros genes. Hoy en día se podría saber si eres poseedor de uno esos genes,(que aunque los tuvieras sólo se manifestaría en 3 de cada 10 personas) .Dicho conocimiento  cuesta unos 90.000 €.¿Qué te dice toda esta información?.
    -¿Qué es para ti "calidad de vida"?
    -¿Cómo se administrarán las vacunas del futuro?
    -Cita un ejemplo en el que nuestra salud no sea mejor que hace 50 años.

    Tarea 1 B

    Texto EL SISTEMA SANITARIO.


    Los zaragozanos son los que más esperan a la hora de entrar en la consulta de los centros de salud, según un estudio de EROSKI CONSUMER. En el caso de Zaragoza, se han visitado diez centros de salud repartidos entre la capital aragonesa y otras localidades de la provincia, donde la espera media para acceder a la consulta ha sido de 30 minutos, que "dobla la media nacional, que es de un cuarto de hora de espera".

    1-Busca información por la situación en Teruel. (no olvides apuntar tu fuente de información)

    Texto 2.
     Publicado en 2010-11

    La ministra de Sanidad y Política Social, Trinidad Jiménez, anunció este miércoles la intención del Gobierno de establecer la llamada 'factura en la sombra', un mecanismo según el cual los ciudadanos que hayan pasado por un hospital conozcan de primera mano el coste real que haya supuesto su estancia, por mínima que sea, a la sanidad española.. La 'factura sombra' no se emitirá en todos los procesos sanitarios, ya que sería "antieconómico".
       Se trata, según ha dicho, de un "ejercicio externo", orientado a informar a los usuarios del sistema sanitario, pero también "interno", ya que al mismo tiempo se trasladará a los profesionales "la importancia de lo que cuestan las cosas".Algunas comunidades como Andalucía, Navarra,Cantabria o Murcia ya han trabajado para su aplicación .
    1-Contrasta/actualiza el texto.
    1-Qué se pretende con esta medida. Busca otras medidas del estado en sanidad para reducir el gasto.
    2-Busca información sobre el precio concreto de determinadas actuaciones. Ej. Un parto sin complicaciones - 1.600 euros.
    (no olvides apuntar tu fuente de información).

    Tarea 2

    Texto  Ética farmaceútica.

    Nigeria demanda Pfizer por ensayar ilegalmente
    sus fármacos sobre la población
    LA OTRA CARA DE LA INDUSTRIA FARMACÉUTICA
    El Gobierno federal nigeriano ha llevado a los tribunales al gigante
    farmacéutico Pfizer por ensayar ilegalmente un fármaco contra
    la meningitis que causó muertes y malformaciones a unos 200 niños,
    informa hoy la prensa local. En su demanda, presentada ayer,
    las autoridades nigerianas piden a la Corte Suprema Federal de
    Abuya 7.000 millones de dólares para compensar los prejuicios
    del ensayo y para indemnizar a las víctimas y a sus familiares, según
    publica el periódico autóctono Guardian News.
    El caso se refiere a unas pruebas clínicas realizadas por la multinacional
    estadounidense en el estado nigeriano de Kano, el más
    extenso del país, durante una epidemia de meningitis en 1996. La
    farmacéutica aprovechó presuntamente la epidemia para experimentar,
    en unos 200 niños enfermos, un nuevo fármaco en desarrollo
    sin tener los permisos del comité ético nigeriano y sin informar
    a las familias.
    De los menores que participaron involuntariamente en los ensayos,
    once murieron y otros sufrieron sordera, ceguera, parálisis
    cerebral y otras malformaciones. El caso salió a la luz en 2000
    tras una investigación del diario estadounidense The Washington
    Post sobre la administración del antibiótico Trovan en los niños
    de Kano, al que siguió una investigación del Ministerio de Sanidad
    nigeriano.
    Laboratorios farmacéuticos multinacionales e investigadores están
    eligiendo con cada vez más frecuencia a India como escenario para
    sus ensayos clínicos de medicamentos en humanos. La ausencia de
    regulaciones, la certeza de que no deberán rendir cuentas a nadie, los
    bajos costos operativos y la amplia disponibilidad de voluntarios para
    las pruebas son las principales razones que atraen a los laboratorios
    a este país. Se estima que 40% de todos los ensayos clínicos en
    humanos se realizan en América Latina, Asia y Europa oriental. En
    2006, Wemos y el Centro de Estudios de las Corporaciones Multinacionales
    prepararon un informe sobre 22 ejemplos de ensayos clínicos
    no éticos, ocho de los cuales se habían realizado en India. Los casos
    locales incluyen a Sun Pharmaceuticals, Novartis, Novo Nordisk,
    Solvay Pharmaceuticals, Johnson & Johnson, Pfizer, Otsuka, Shantha
    Biotechnics y la Universidad Johns Hopkins.

    1. Expón una opinión fundamentada sobre los textos.
    2. ¿Se te ocurre otra “solución” para mantener tu “calidad de vida”?

    Tarea 3.

    Los genéricos ‘lían’ a las personas mayores

    Confusión entre los mayores es lo que ha generado el primer día laboral de dispensación de medicamentos genéricos, tras la entrada en vigor del real decreto del Gobierno el día de Todos los Santos. “La gente, en general, lo entienden, pero los más mayores se lían un poco, ya que están acostumbrados a tomarse el mismo tipo de medicina desde hace años”, explican desde Costur. “Lo que hacemos es explicárselo a sus familiares o bien enviarlos de nuevo al médico para que se lo haga entender”. Diferente ha sido la acogida de la clientela de farmacias como la de Barreda-Ramos de Castellón, donde “la gente ha venido concienciada”, u otras de Aragón donde ya se venían dispensando . Otros farmacéuticos reconocen que “aún dispensamos marcas de los tratamientos antiguos, por lo que el genérico se renovará de forma gradual”. H.
                                                                                                                             3-11-11

    1. A qué se llama genérico.
    2- Busca noticias en la prensa (vale buscarlas en la red) sobre ellos, apunta el titular, un brevísimo resumen y el periódico-fuente.

    Tarea 4   Desarrollo de los fármacos.







    Veamos el documental  "cobayas humanas" en el qué un conciudadano nuestro explicará los efectos que le causó un fármaco...  Contestaremos a intervalos de 15' las siguientes cuestiones.

    1-¿Qué fármaco le causó a Pepe Marqués sus "deformaciones2
    2-¿Cuánto dura una patente?
    3-Cuánto cuesta colocar un medicamento en el mercado?
    4-¿Hasta cuánto pagan por ser una cobaya ? ¿Qué medicamento prueban el vídeo?
    5-¿Cuál es el objetivo de tomar tantas muestras de sangre?¿Hasta cuántas extracciones realizan?
    6-¿Qué fuentes(entidades,leyes...) regulan "los ensayos clínicos"?
    7-Cita la condición que ha de cumplir un enfermo de cáncer para ser admitido en el ensayo.
    8-¿Qué es el CAIBER?
    9-Cita algún caso de fracaso en un ensayo.
    10-¿Cuántas fases tiene el estudio y/o ensayo clínico?


    Tarea 5 




    Importancia del prospecto.

    Tarea 6


       Sharapova y el meldonium

    Test bloque Avances en biomedicina



    1-La salud comprende: a) La ausencia de enfermedad b) El estado psicológico c) La situación social. d) Todos.
    2-La salud de un individuo depende de : a) Su biología(genética) b)Del medio. c) Del sistema sanitario d) De sus hábitos e) Todos.
    3-Las personas que influyen en tu salud son: a) Tu mismo b) Tus padres c) Tus profes. d) Médicos y psicólogos e) Tus compañeros e) Todos.

       
          QUÉ TAL UN POCO DE HISTORIA

    4-Pertenece a la época clásica :a) Hipócrates de Cos.b) Galeno de Pérgamo.c) Avicena. d) Miguel Servet.
    5-Pertenece a la época Helenística :a) Hipócrates de Cos.b) Galeno de Pérgamo.c) Avicena. d)Miguel Servet.
    6-Pertenece a la Edad Media :a) Hipócrates de Cos.b) Galeno de Pérgamo.c) Avicena. d)Miguel Servet.
    7-Pertenece a la época renacentista :a) Hipócrates de Cos.b) Galeno de Pérgamo.c) Avicena. d)Miguel Servet.


                                                   MEDICINAS ALTERNATIVAS

    -A parte de la medicina más utilizada en paises como los de la UE, de América etc.llamada "convencional u occidental existe otra medicina que en "contraposición" llamamos no convencional o alternativa con características como: a) Comprende prácticas,terapias y productos b) Mayoritariamente tradicionales y/o naturales c) Muchas no siguen el método científico d) Todas.
    -La medicina alternativa se clasifica en:a) M. orientales b) M. naturales c) M. de manipulación d) M. activas d) M. "espirituales" e) Todas.
    -La fitoterapia china y la acupuntura es un tipo de medicina:a) M. orientales b) M. naturales c) M. de manipulación d) M. activas d) M. "espirituales"
    -La fitoterapia es un tipo de medicina:a) M. orientales b) M. naturales c) M. de manipulación d) M. activas d) M. "espirituales"
    -La osteopatía y la quiropraxis  es un tipo de medicina:a) M. orientales b) M. naturales c) M. de manipulación d) M. activas d) M. "espirituales"
    -La homeopatía  es un tipo de medicina:a) M. orientales b) M. naturales c) M. de manipulación d) M. activas d) M. "espirituales"

    CCBB 
    CM,AA

      En la homeopatía la dilución de la sustancia terapeútica 1ch significa que una gota de aquella se mezcla con 99 de una disolución de agua y alcohol.¿Qué significará 6ch? ¿Seguirá habiendo sustancia en 30 ch?.Explícalo científicamente.(N.avogadro)

    -El Yoga y el tai-chi  es un tipo de medicina:a) M. orientales b) M. naturales c) M. de manipulación d) M. activas. d) M. "espirituales"
    -En la aromaterapia la esencia del árbol del té se utiliza: a) Habitación de un enfermo b) En tu lugar de trabajo c) En tu dormitorio
    -En la aromaterapia la esencia de lavanda o manzanilla se utiliza: a) Habitación de un enfermo b) En tu lugar de trabajo c) En tu dormitorio.
     -En la aromaterapia la esencia de romero o limón se utiliza: a) Habitación de un enfermo b) En tu lugar de trabajo c) En tu dormitorio

     Masaje ayurvédico y aceites esenciales.

    - La musicoterapia y la gemoterapia son un tipo de medicina:a) M. orientales b) M. naturales c) M. de manipulación d) M. activas d) M. "espirituales"
    -La unión de la medicina convencional y la m. alternativa recibe el nombre de: a) Dual b) Mejor c) Integrativa.

    Sumando musicoterapia y fitoterapia.

    Video de La noche temática Medicina tradicional china.


    8-El diagnóstico de una enfermedad(medicina convencional) se basa en: a)Entrevista clínica o anamnesis b) La exploración física c) Exploraciones complementarias d)Historia clínica.e) Todas ellas.
    -Es un tipo de exploración física: a) Inspección y palpación b) Percusión y auscultación c) Oler d) a y b d) Todas
    -Son exploraciones complementarias: a) Pruebas de laboratorio b) Técnicas de diagnóstico por imagen c) Técnicas endoscópicas d) Biopsia d) todas
    -Son técnicas de diagnóstico por imagen: a) Radiografía y ecografía b) TAC y PET c)  RMN d) Todas


    CCBB
    CS,CD.

    Tarea: Elige uno de estos tipos de tratamiento y busca un video para explicarlo.

    -Tipos de tratamientos de las enfermedades:

    Acupuntura
    Cirugía o tratamiento quirúrgico
    Dieta
    Farmacoterapia o tratamiento con medicamentos
    Fisioterapia
    Fitoterapia
    Hidroterapia
    Logopedia
    Ortopedia
    Prótesis: dentales, lentes, etc
    Psicoterapia
    Quimioterapia
    Radioterapia
    Rehabilitación o tratamiento rehabilitador.
    Reposo domiciliario
    Sueroterapia
    Terapia de quelación

    Terapia ocupacional
    9.-¿Cuántos modelos sanitarios existen? a) modelo liberal , modelo socialista y modelo general. b) modelo mixto, modelo general y modelo liberal. c) modelo liberal, modelo socialista y modelo mixto.

        

    Resumen de 40' de la peli Sicko

    Cuestiones.
    1-Indica dos características del S.S de EEUU
    2-INDICA una que no te guste

    10.- La diabetes II está originada por: a) Una bacteria. b) Desórdenes alimentarios. c) Un parásito.
    11.- ¿Cuál de las siguientes enfermedades se caracteriza por contracciones musculares violentas? a) Osteoartritis. b) Distrofia muscular. c ) Tétanos.
    12.- Las alteraciones que siente y relata el paciente, que no se pueden medir, son :a) Prueba complementaria. b) Síntoma c) Signo.
    13.- Una proteína anómala  que puede inducir a que su homóloga normal se convierta en anómala, es un:a) Prión. b) Virus. c) Hongo.

                                                  TRASPLANTES


    14.-¿Cómo se llama el trasplante entre especies diferentes? a) Autotrasplante(o autoinjerto) b) Alotrasplante c) Xenotrasplante d) Isoinjerto


    s.III d.c


     (T. de pierna)

    -El organismo dependiente del ministerio de sanidad que gestiona los trasplantes en España es: a) ONT b) OMT c) TON
    -El marco legal que regula la gestion de los T. es: a) RD 1723/2012 de 28 de diciembre. b)RD 1733/2012 de 28 de diciembre c) RD 1723/2016 de 28 de diciembre
    -La ley prohibe la extracción de órganos a menores de edad : V F

    -Un trasplante de un órgano al lugar original es un t. : a) Ortópico b) Ortotópico c) Heterotópico
    -Cuál es el orden decreciente en sobrevivir antes de ser trasplantados de los siguientes órganos: a) Corazón,hígado,pulmón, riñon b)Pulmón,corazón,hígado, riñon c)Riñon,pulmón, hígado, corazón.
    -Los tipos de rechazo a un trasplante pueden ser: a) Agudo(h. 15% de los pacientes) b) Hiperagudo c) crónico d) Todos
    -Las moléculas implicadas en el rechazo de un órgano trasplantado son: a) Complemento b) HLA clase I c) HLA clase II d)Ig M e IgG e)Todas
    -El número de trasplantes diario en España(2106) es de: a)10 b)15 c) 13.
    -

       El tercer trasplante de cara realizado en enero de 2007  era por un tumor de gran tamaño causado por una neurofibromatosis de tipo I, una de las posibilidades presentadas para el caso de John Merrick, el “Hombre Elefante”.

      Tráfico de órganos 9'

    Ventajas y Desventajas del trasplante de órganos

    Tarea:

    Grupo A(grupo de alumnos previamente escogido)

    -Escoge aquella ventaja que a tu parecer te inhibiría de tener en cuenta cualquier desventaja.

    Grupo B

    -¿Hay alguna desventaja que a tu parecer te inhibiría de tener en cuenta cualquier ventaja?.



    Ventajas:


    1.              Se puede salvar una vida en peligro.
    2.              La cura de una enfermedad.
    3.              El tejido, ligamento, células o  el órgano que sea sometido a un trasplante, no tendrá marcas de una enfermedad previa.
    4.              Se pueden realizar terapias genéticas(p.e. células modificadas genéticamente), si es necesario, al paciente.
    5.              Se mejora la calidad de vida de la persona, una vez tenga un órgano en su cuerpo que funcione adecuadamente.

     Desventajas:


    1.    Se pueden encontrar problemas de compatibilidad entre el donante y al que se le va a trasplantar el órgano.
    2.    El costo de la cirugía u operación es bastante caro.
    3.    Hay grandes probabilidades, que el donante que se necesita, no se encuentre a su debido tiempo y el paciente puede morir.
    4.    Se pueden encontrar en el paciente, en plena operación, que hay grandes posibilidades de una infección luego de la cirugía.
    5.    En algunos casos, si el donante sufre del corazón  en medio del trasplante puede darle un paro cardíaco.


    15.- ¿Cual es la forma de contagio de la hepatitis B? a) vectores b) ingestion de alimentos contaminados c) via sanguínea.
    -Son casos de zoonosis: A:Rabia B: Gripe Aviar C: EVE(Ébola) D: Todos
     
    16.- ¿ El parkinson, que tipo de enfermedad es? a)Mental y degenerativa b) Vírica y degenerativa .c)Cardiovascular y hereditaria.

    17.- ¿ Que es una enfermedad endémica? a) La que afecta a varios continentes. b) La que aparece en un lugar determinado. c) La que se da solo esporádicamente.
    18. ¿ Como podria contagiarse la malaria? a) Solo a través de picadura del mosquito "anopheles". b) Anopheles ,transfusiones sanguíneas o transplante de órganos contaminados c) A traves de las anteriores, respiración y saliva también.

    19- ¿Cómo puedes contraer la salmonelosis? a) A través de aires acondicionados. b) Por la picadura de un mosquito. c) Ingiriendo alimentos en mal estado.

    20.- ¿Para qué tipo de patógeno recetan antibióticos? a) Virus. b) Bacterias. c) Hongos. 
    21.- Las barreras anatómicas como la piel son defensas: a) inducidas. b) externas.c) internas.

    22.- La molécula que induce la formación de anticuerpos se llama:a) Leucocito b) Linfocito. c) Antígeno.
    23.-El nombre con el que se conoce al estudio de las enfermedades es: a) Etiología b) Patología c)Patogenia
    24.-El tipo de grasas que se encuentra principalmente en los alimentos industrializados y que son nocivas son
    a) Trangrasas  b) Grasas Trans c) Grasas insaturadas.


     -Molécula contenida en el chile,guindillas y otros pimientos que pica mucho pero puede hacer adelgazar e incluso se dice protege contra algunos cánceres: A:Capsaicina B: Casipica C:Quesipica

    25.El llamado "colesterol malo" en un análisis de sangre es técnicamente: a) triglicéridos. b) HDL. c) LDL.
     -Molécula antioxidante y catalogada como anticancerígena que se encuentra en el vino: A:Resperatrol b: Resveratrol C:Espera-troll                           
    26.-Elige la respuesta correcta: Los cuatro aspectos de una enfermedad son…a) Etiología, patología, cambios morfosintácticos y alteraciones funcionales. b) Etiología, patogenia, cambios morfológicos y alteraciones funcionales. c) Etiología, patología, cambios morfológicos y alteraciones disfuncionales
    27.-¿Con qué nombre se conoce a la bacteria que produce la úlcera?. a) Anisakis b) Yersinia Pestis c) Helicobacter Pylori.
    28.-¿Qué es un vector? a) Ser vivo que lleva un patógeno. b)  Personas toman agua contaminada . c) las dos son correctas.
    29.-¿Cuál es el agente patógeno de la candidiasis? A- Prión B- Virus C- Hongos.

    30- Entre las enfermedades mentales podemos encontrar: A- Psicosis, trastornos orgánicos, trastornos afectivos, neurosis y trastornos de ansiedad. B-Transtornos orgánicos, trastornos ambientales y afectivos y neurosis.C- Trastornos hereditarios, psicosis y ansiosos-cardiovasculares.
    31.- Ciencia que estudia las causas de las enfermedades :A- Clínica B- Etiología C- Fisiopatología.
    32.- ¿Cuál NO es un tipo de defensa? A- Respuesta inflamatoria B- Picor. C- Defensa fagocitaria.
    33- Ciencia que analiza las modificaciones funcionales que va sufriendo el enfermo. A- Patogenia B-Epiotología C- Fisiopatología
    34.- Forma acelular formada por un ácido nucleico, rodeado de una envoltura de proteínas y cuya única actividad vital es la reproducción: A- Virus. B- Bacteria. C-Prión.


    35- Enfermedad que consiste en la degeneración del tejido cartilaginoso de las articulaciones :A- Distrofia muscular. B- Osteoartritis.C- Enfermedad coronaria.
    36.- Etapas por las que pasa una enfermdad :A- Incubación, desarrollo y convalecencia. B- Contagio, desarrollo y curación. C- Incubación, transmisión y convalecencia.

    37.- Ciencia que estudia las señales que delatan la enfermedad (para ello se utilizan los signos, los síntomas y pruebas complementarias) :A- Etiología. B- Clínica. C- Patogenia.
    38.- La fiebre es :A- Prueba diagnóstica B- Síntoma C- Ninguna es correcta.
    39- Las enfermedades parasitarias pueden estar causadas por: A- Bacteria y metazoos. B- Hongos y metazoos. C- Protozoos y metazoos.
    40- ¿Cuáles de estas opciones son pruebas diagnósticas A- Radiografía y análisis de sangre. B- Vacunación y medicación. C- Malestar y vómitos.
    -¿Qué se entiende por "caso índice"?: A: Indica un caso ,sobre ciertas enfermedades, muy importante B: Es el "paciente cero" o primera persona que se contagia de cierta enfermedad. C: Patología del dedo que lleva su nombre
    41- Cuando una enfermedad afecta a varios continentes se llama :A- Pandemia. B- Endemia C- Epidemia.
    -Para que sea declarada epidemia el nº de casos de gripe por cada 100.000 habitantes ha de ser de: a) 60 b)70 .c) 80
    1/2017-¿Qué tienen en común el SIDA,la tuberculosis y la malaria? a)Son enfermedades producidas por microorganismos b) Son pandemias c) Son curables
    -Son números del SIDA en el mundo: a)20 millones de infectados,un tercio atendido b) 30 m. ,la mitad atendidoc)35 m,la mitad atendido 
    -Son números del SIDA en España: a) 130.000 afectados,30% no lo saben b) 250.000/30% c) 310.000/40%
    -El ritmo de nuevos casos de SIDA en España es de aprox.:a) 7 al día b) 25 al día c) 10 al día

        Una pastilla (atripla)al día cronifica la enfermedad.(1000/ mes.Seguridad social)

    42- ¿Cuál de estas enfermedades se puede transmitir de unas personas a otras? A- Diabetes. B- Legionella. C- Sarampión.

    43- De estas enfermedades, ¿cuáles son degenerativas? A- Gota y artritis. B-Alzheimer y parkinson. C- Hipertensión y tiña.
    44- Los contaminantes pueden ser:A- Físicos y químicos .B-Biológicos .C-A y B son correctas.
    45- De estas enfermedades una no es cadiovascular, ¿cuál? A- Infarto de miocardio. B- Cotard. C- Trombosis.
    46-Las enfermedades supuestamente controladas o desaparecidas, pero que en un momento dado vuelven a constituir una amenaza sanitaria, se llaman: a-) Enfermedades emergentes. b-) Enfermedades reemergentes. c-) Enfermedades latentes.
    47-Son defensas artificiales frente a las enfermedades: a) Cirugía, barreras anatómicas, medicamentos.b)Trasplantes, medicamentos, defensas constitutivas .c)Trasplantes, cirugía, medicamentos.
    48- El cáncer se trata con :a-)Cirugía, radioterapia, quimioterapia. b-) Radioterapia, quimioterapia , analgésicos. c-) Quimioterapia, cirugía, analgésicos.
    49-Algunas pruebas complementarias para el diagnóstico de una enfermedad son:a) Presión arterial, punciones, análisis de orina. b) Temperatura corporal, punciones, presión arterial. c-) Análisis de sangre, radiografías, punciones.
    50. ¿Qué enfermedad puede llegar a manifestarse por el abuso de grasas trans? a) Diabetes tipo I.b) Diabetes tipo II.c) Botulismo.


    51. ¿ Cuál de las siguientes opciones es una prueba diagnóstica? a) Administración de antibióticos b) Cirugía c) Medida de la presión arterial 
    52.¿ Por qué se caracteriza el periodo ventana de una enfermedad? a) Se pueden observar los síntomas b) La enfermedad no se manifiesta c) No se puede contagiar la enfermedad
    53. ¿Qué agente produce la toxoplasmosis? a) el toxoplasma cloridium b) el toxoplasma gondii c) treponema pallidum.

    54 .La enfermedad de Creutfeld-Jacob es producida por: a)un virus. b) una bacteria. c) un prión.
    55 .Enfermedad que produce perdida de facultades intelectuales y memoria es: a) esquizofrenia. b) alzheimer c)parkinson.
    56.La heroína actúa sobre el sistema nervioso de forma: A) Estimulante. B) Perturbadora. C) Depresora.
    57. La salmonelosis se puede transmitir: A) Por alimentos. B) Por contacto. C) Por vectores.
    58. ¿Para que enfermedad se utilizan los medicamentos citostáticos: A) Tuberculosis. B) Cáncer. C) Alzheimer.
    cancer
    59. La enfermedad del paludismo o malaria, está generada por la picadura del mosquito hembra anopheles, que transporta un microorganismo llamado: A) palodium B) anophelium C) plasmodium.

    60. La tiña es una enfermedad : A) producida por hongos. B) producida por parásitos C) de origen vírico.

    61. La necesidad de incrementar la dosis de la sustancia consumida para obtener los mismos efectos es: A) La dependencia B) La tolerancia C) La adicción.

    62.Los medicamentos que no tienen marca pero que tienen el mismo principio activo (que es lo que cura)  se denominan: A) Genéricos B) Generales C) Patentados. 
    63.¿ Qué tipo de dependencia produce la cocaína? a) física b) física y psíquica c) psíquica.
    64.Los antipiréticos se utilizan para: a) Rebajar un hinchazón. b) Bajar la fiebre. c) Dolor de estómago.
    65.¿Cual es el objetivo de la patogenia? a) Cualquier enfremedad.b) El mecanismo de acción de la enfermedad.c) Los síntomas de una enfermedad.
    66..-El proceso de envejecimiento se debe a: a)factores genéticos y psíquicos.b)factores ambientales y genéticos c)factores higiénicos y estéticos.

    67.-  El proceso de clonación se hace de forma:a) Asexual .b) Bisexual. c) Sexual.
    68.- Un posible uso de la clonación podría ser:a) La mejora de la calidad de las células del ser clonado.b) La obtención de animales transgénicos para diversos fines.c) La creación de un súperejército.

    69.- Las células madre pueden ser:a) Megapotentes, uvipotentes, tutipotentes y pluripotentes.b) Multipotentes, totipotentes, ovnipotentes y pluripotentes.c) Multipotentes, pluripotentes, totipotentes y unipotentes.

    70.- La terapia celular con células madre hace posible:a) La clonación de órganos necesarios para trasplantes.b) La formación de genes en el ADN de la célula utilizada c) Crear células somáticas para que empiece el programa embrionario
    71.- La obtención de un clon de un organismo pluricelular se produce al: a) Extraer el núcleo de un óvulo y desecharlo para introducir una célula madre embrionaria.b) Extraer el núcleo de un óvulo e introducirle el de una célula del organismo a clonar.c) Extraer el núcleo de un óvulo, introducir una célula e iniciar una división electrónica de un cigoto.

    72. La mayoría de las vacunas son inyectables, aunque algunas se administran por vía oral, en particular la: a) La vacuna Ferrán-Cajal del cólera b) La de Pasteur contra la rabia c) La de salk-Sabin contra la polio d) La de la viruela de Jenner e) La de Calmette y Guerin contra la tuberculosis.

    73. Pian es una enfermedad; a) Causada por la bacteria treponema.b) Es "pariente" de la sífilis.c)Ha contribuido notablemente un español en su lucha.d) Todas son ciertas.
    74. El número de personas que muere al día en europa por mal uso de los medicamentos es: a)6. b)60. c).600.
    75.La cuarta causa de muerte en europa tras el infarto,el ictus y el cáncer es: a) Las infecciones. b).Los efectos secundarios de los medicamentos. c)El hambre.
    76.-Son enfermedades iatrogénicas: a) Las causadas por el médico b) Las causadas por el tratamiento c) Las causadas por los medicamentos d) Todas son ciertas.
    - Podría ser la primera causa de muerte en EE.UU: a) Las infecciones. b).Las e. iatrogénicas. c)El cáncer d) Los ACV(accidente cerebro vascular)
    77.Son medicamentos huérfanos aquellos que: a) Son fabricados  para enfermedades raras. b) Están caducados c) No está claro su orígen.




    SECCIÓN TESTIMONIOS

    Esto fue lo que le pasó a Pablo, de 31 años. Hace dos fue diagnosticado de Lyme crónico (también conocido como Lyme tardío), una enfermedad rara que se produce después de que te haya picado una garrapata y ésta te haya infectado con la bacteria Borrelia. Pablo ni siquiera sabe cuándo le picó. Cree que fue hace más de 10 años, pero a día de hoy la infección sigue agarrada a su cuerpo. Lleva todo este tiempo tratándose con antibióticos.
    Cuando le diagnosticaron, Pablo no conocía a nadie con la enfermedad, pero quería tener información sobre la misma de primera mano, de pacientes como él. Así que, dicho y hecho: a través de datos de gente que había encontrado por grupos de Facebook, creó un mapa del Lyme. "En una semana ya había 1.000 usuarios", explica Elisa, su novia.
    Más tarde, Elisa, que fue diagnosticada de la enfermedad de Crohn hace dos años, le pidió que hiciera otro de su dolencia, con lo que nació el segundo mapa. A continuación, como los dos son celiacos, hicieron otro de la celiaquía. "Después, varios amigos nos iban diciendo que creásemos mapas de sus enfermedades, así que pensamos que en lugar de utilizar un dominio web para cada enfermedad, por qué no hacer un mapa global que alojara todas las enfermedades", cuenta Pablo.
    Y es así como nació Disease Maps, en español Mapa de las enfermedades, que pretende poner en contacto de una forma muy sencilla a personas que comparten un mismo diagnóstico. Aunque el proyecto está abierto a todas las patologías, es en las enfermedades raras donde hacen más hincapié, porque son conscientes de la importancia de encontrar a alguien que está pasando por lo mismo que tú cuando hay tan pocos pacientes en el mundo. "Yo siempre digo que los mapas que tienen 20 personas son mucho más útiles que los que tienen 10.000", dice Pablo.
    La web nació en julio de 2015 y, hasta la fecha, agrupa a 756 enfermedades y tiene 115.000 usuarios registrados entre pacientes, médicos e investigadores. Traducida a siete idiomas (gracias a traductores altruistas, explican los fundadores), Disease Maps se ha convertido en el gran proyecto personal de Pablo que, debido a su delicado estado de salud, no puede salir de casa.

    Día de las E.R

    Las E.R:

    -Cada semana surgen 5 nuevas E.R
    -Afectan a menos de 5 de cada 10.000 habitantes.
    -En España hay unos 3 millones de personas.
     -En el mundo existen alrededor de 7.000 variedades de enfermedades raras; en un 50% de los casos se manifiestan en la infancia y aproximadamente el 30% de los niños mueren antes de cumplir los cinco años, según datos de la SEN.
    El 85% de estas patologías son crónicas, el 65% graves e invalidantes, muchas de ellas degenerativas, en el 75% de los casos la persona tiene algún grado de dependencia y en más del 80% discapacidad física y emocional.
       De acuerdo con un estudio de FEDER , uno de cada tres familiares ha tenido que reducir jornada laboral o dejar de trabajar y el coste de la diagnosis y el tratamiento de la enfermedad representa el 20% de los ingresos anuales de cada familia.

    77.No es un tipo de terapia(medicina) alternativa; a)T.Génica b) Relajación c) Homeopatía d)Acupuntura
    Medicamentos

    78.Medicamento que alivian el dolor:Antipirético. Antibiótico. Diurético. Antiemético. Psicotrópico.Analgésico.
    79.Medicamento que evita los vómitos:Antipirético. Antibiótico. Diurético. Antiemético. Psicotrópico.Analgésico.
    80.Medicamento que actúa en el S.N :Antipirético. Antibiótico. Diurético. Antiemético.Psicotrópico.Analgésico.
    81.Se estima en unos 17 m. de muertes al año en el mundo las enfermedades de tipo:a)Infecciosas b) cardiovasculares c) traumáticas d) a y b.
    82.Son agencias reguladoras de los medicamentos: a)AEMPS-Agencia española del medicamento y productos sanitarios (Esp) b) FDA( Nort.) c) EMA(Eur) d)MHLW(Jap) e) Todas.


    Ampliación-teoría para hacer el test



    Test Drogas-Varias respuestas.


    1-El GHB(gamahidroxibutirato) : a)Es lo que se llama éxtasis líquidob)Tiene un efecto estimulantec)Tiene efectos anestésicosd)Por su forma, color y olor, en ocasiones se puede confundir con agua.e)Es habitual encontrárselo en ambientes de fiesta.
    2- Esteroides:a).A los hombres les crece el pecho y a las mujeres se les agrava la voz.b)El consumo continuado de esteroides ayuda al crecimiento, sobre todo cuando lo toman personas jóvenes c)Los esteroides que circulan por algunos gimnasios son buenos porque ayudan a "ponerse cachas" d).En los hombres, el consumo a largo plazo de esteroides puede producir esterilidad e impotencia, a la vez que aumenta la agresividad y los sentimientos paranoicos.e)Los esteroides se toman continuamente durante años
    3-La ketamina:a). tiene un potente efecto anestésico y disminuye la frecuencia respiratoria.b)Los efectos de la ketamina suelen durar entre 5 y 8 horas c).La ketamina genera tolerancia, por lo que cuando alguien la toma frecuentemente, le hará falta una dosis mayor para consegir el mismo efecto inicial.d).La ketamina no produce alucinaciones o "viajes".e)La ketamina es más peligrosa para las personas que no están habituadas a otras drogas, como la cocaína o el speed 
    4-Los inhalantes(ej.pegamento): a).Son sustancias legales y se pueden encontrar fácilmente en cualquier casa, colegio o lugar de trabajo.b)No ponen en riesgo la vida c).Producen tanta excitación que provoca cada vez más violencia física y/o verbal.d)Para mantener el efecto hay que inhalar aproximadamente cada 4 ó 6 horas e)Te mantienen alerta y no tienes ganas de dormir
    5-La heroína:a) Fumada produce menos dependencia que inyectada b).Es un analgésico muy potente.c).Produce sentimientos de ansiedad y nerviosismo cuando se pasan sus efectos.d)Aumenta los deseos sexuales e)Puede utilizarse junto a tranquilizantes, metadona y/o alcohol sin problemas especiales
    6-Los tranquilizantes(ej. benzodiacepinas): a) .Reducen los efectos negativos de los estimulantes.b)No produce dependencia física c).Puede crear ansiedad, pánico y crisis epilépticas cuando la dejas de tomar.d)No siempre se necesita receta médica para conseguirlos e)Se pueden tomar con alcohol y otros medicamentos sin problemas
    7-Los alucinógenos (ej. LSD,tripis,hongos): a).Distorsionan la percepción visual, auditiva y táctil.b)Es fácil controlar sus efectos y no es una droga muy peligrosa c)Tomando un trozo pequeño se consume poca sustancia d)Los efectos dependen exclusivamente de la calidad que tenga la sustancia e).El viaje no se puede parar y puede durar hasta 12 horas.
    8-El éxtasis: a) Las pastillas iguales en la forma tienen la misma composición b).Es adecuado beber 3/4 de litro de agua por hora si estás bailando y sudando.c)El agua potencia sus efectos d).Cuando pasan sus efectos puede producir cansancio y depresión.e).Tomado con alcohol aumenta la deshidratación.
    9-Las anfetaminas ,el Speed : a).Se puede estar de fiesta y bailar mucho tiempo. b) Los efectos pueden durar un máximo de media hora c)Ayuda a retener la información d).Quita el apetito y reduce las ganas de comer.e).No se puede dormir aún estando cansado.

       La pervitina en la 2ª guerra mundial.

    10-La cocaína : a). Es estimulante y hace que te mantengas despierto y alerta.b).Puede producir alucinaciones visuales o auditivas si el consumo es frecuente o a dosis elevadas.c).Produce agresividad, y hace que cualquier cosa moleste.d)Una cantidad pequeña mantiene sus efectos entre 6 y 8 horas e)El consumo de alcohol reduce los deseos de consumo de cocaína


    11-Los porros( cannabis,hachís,marihuana) :a)No produce ningún tipo de dependenciab).Produce olvidos y pensamiento confuso.c).Parece que tardas más tiempo en hacer las cosas y que tu movimiento es más lento.d).No es una sustancia que altera la forma de percibir las cosas.e)Generalmente produce una disminución del interés por las cosas y permite alejarse de la realidad
    12-El tabaco: a) es un relajante que deprime el sistema nervios.b)El efecto de la nicotina dura dos horasc)Dificulta la circulación sanguínea, produce enfermedades pulmonares y bronquitis crónicas.d).Las ganas de fumar permanecen durante muchos años.e).Al dejar de fumar se engorda mucho.
    13-El alcohol: a).Al principio desinhibe, después deprime y adormece.b).Altera la conciencia, las capacidades de conocer, recordar y calcular.c)Hace que te mantengas alertad).Genera más agresividad.e)La misma cantidad afecta igual a los hombres que a las mujeres

    Corto "Rebobina"





    Vídeo online programa El escarabajo verde Doctor animal




      Tareas "puente " entre los dos bloques:


      Después del visonado de la película "el aceite de la vida"contesta a las siguientes preguntas:

    1- Al aparecer los primeros síntomas se especula sobre posibles explicaciones (p. ej., síndrome de hiperactividad), ¿qué otras posibilidades son consideradas? (hay otras cuatro), ¿cuál se selecciona como más plausible?
    2- ¿Qué hipótesis de investigación plantean los padres de Lorenzo acerca del nivel de grasas saturadas en la sangre?
    3-¿Qué aspecto de la investigación científica mostrado en la película te ha llamado particularmente la atención?, ¿Por qué motivo?



      Después del visonado del docu El árbol genealógico humano,contesta a las siguientes preguntas:


    1-Cómo se llama el proyecto para descubrir nuestros orígenes?
    2-Dónde y cuándo aparece H. Sapiens. Pq salen de sus límites.
    3-¿Cómo pasa la información genética de generación en generación en los hombres y mujeres?
    4-¿Cuantas generaciones atrás se remontan nuestros orígenes?
    5-¿Qué son los marcadores genéticos?
    6-¿Cuánto tiempo permanecieron en Africa?
    7-¿Cuándo se bifurca la rama del Homo Sapiens?
    8-¿Qué ocurrió durante la" megasequía"?
    9-¿De dónde proceden el 50% de los europeos?
    10-¿Qué explicación da el docu para la aparición de la raza caucásica(blanca)?
    11-¿Cuál es el último lugar de Europa donde llegó Homo Sapiens?
    12-¡Qué es un coprolito?¿Por qué es importante?

    Bloque 4. La revolución genética


    Criterios de evaluación

    1. Reconocer los hechos históricos más relevantes para el estudio de la genética.
    2. Obtener, seleccionar y valorar informaciones sobre el ADN, el código genético, la ingeniería
    genética y sus aplicaciones médicas.
    3.  Conocer  los  proyectos  que  se  desarrollan  actualmente  como  consecuencia  de  descifrar el
    genoma humano, tales como HapMap y Encode.
    4. Evaluar las aplicaciones de la ingeniería genética en la obtención de fármacos, transgénicos
    y terapias génicas.
    5. Valorar las repercusiones sociales de la reproducción asistida, la selección y conservación de
    embriones.
    6. Analizar los posibles usos de la clonación.
    7.  Establecer  el  método  de  obtención  de  los  distintos  tipos  de  células  madre,  así  como  su
    potencialidad para generar tejidos, órganos e incluso organismos completos.
    8.  Identificar  algunos  problemas  sociales  y  dilemas  morales  debidos  a  la  aplicación  de  la
    genética: obtención de transgénicos, reproducción asistida y clonación.
    Estándares de aprendizaje evaluables
    1.1. Conoce y explica el desarrollo histórico de los estudios llevados a cabo dentro del campo
    de la genética.
    2.1.  Sabe  ubicar  la  información  genética que  posee  todo  ser  vivo,  estableciendo  la  relación
    jerárquica entre las distintas estructuras, desde el nucleótido hasta los genes responsables de
    la herencia.
    3.1.  Conoce  y  explica  la  forma  en  que  se  codifica  la  información  genética  en  el  ADN  ,
    justificando  la  necesidad  de  obtener  el  genoma  completo  de  un  individuo  y  descifrar  su
    significado.5
    4.1.  Analiza  las  aplicaciones  de  la  ingeniería  genética  en  la  obtención  de  fármacos,
    transgénicos y terapias génicas.
    5.1. Establece las repercusiones sociales y económicas de la reproducción asistida, la selección
    y conservación de embriones.
    6.1. Describe y analiza las posibilidades que ofrece la clonación en diferentes campos.
    7.1. Reconoce los diferentes tipos de células madre en función de su procedencia y capacidad
    generativa, estableciendo en cada caso las aplicaciones principales.
    8.1.  Valora,  de  forma  crítica,  los  avances  científicos  relacionados  con  la  genética,  sus  usos  y
    consecuencias médicas y sociales.
    8.2.  Explica  las  ventajas  e  inconvenientes  de  los  alimentos  transgénicos,  razonando  la
    conveniencia o no de su uso.



            LA REVOLUCIÓN GENÉTICA




       Los genes no nos determinan sólo nos influyen. Son un potencial moldeado por el entorno.

    Parte 1
    Parte 2

    Preguntas:



    Sigamos con otro vídeo(programa tres14-La herencia)




    Contesta a las siguientes preguntas:


    Tareas

    Tareas para todos los bachilleratos.

    CC tarea 1

    ¿Qué es la clonación?

    Si nos referimos al ámbito de la Ingeniería Genética, clonar es                 
    aislar y multiplicar en tubo de ensayo un determinado gen o, en
    general, un trozo de ADN. Sin embargo, Dolly no es producto de
    Ingeniería Genética. En el contexto a que nos referimos, clonar
    significa obtener un individuo a partir de una célula o de un núcleo
    de otro individuo.
    En los animales superiores, la única forma de reproducción es
    la sexual, por la que dos células germinales (óvulo y espermatozoide)
    se unen, formando un zigoto (o huevo), que se desarrollará
    hasta dar el individuo adulto. Las células de un animal proceden
    en última instancia de la división repetida y diferenciación
    del zigoto. Las células somáticas, que constituyen los tejidos del
    animal adulto, han recorrido un largo camino “sin retorno”, de
    modo que, a diferencia de las células de las primeras fases del embrión,
    han perdido la capacidad de generar nuevos individuos y cada
    tipo se ha especializado en una función distinta (a pesar de que,
    salvo excepciones, contienen el mismo material genético).
    No es extraño pues el revuelo científico cuando el equipo de
    Ian Wilmut, del Instituto Roslin de Edimburgo comunicó que
    habían logrado una oveja por clonación a partir de una célula
    diferenciada de un adulto. Esencialmente el método (que aún
    presenta una alta tasa de fracasos) consiste en obtener un óvulo
    de oveja, eliminarle su núcleo, sustituirlo por un núcleo de célula
    de oveja adulta (en este caso, de las mamas), e implantarlo en
    una tercera oveja que sirve como “madre de alquiler” para llevar
    el embarazo. Así pues, Dolly carece de padre y es el producto de
    tres “madres”: la donadora del óvulo contribuye con el citoplasma
    (que contiene, además mitocondrias que llevan un poco de
    material genético), la donadora del núcleo (que es la que aporta
    la inmensa mayoría del ADN), y la que parió, que genéticamente
    no aporta nada.
    Científicamente se trata de un logro muy interesante, ya que
    demuestra que, al menos bajo determinadas circunstancias es posible
    “reprogramar” el material genético nuclear de una célula
    diferenciada (algo así como volver a poner a cero su reloj, de
    modo que se comporta como el de un zigoto). De este modo, este
    núcleo comienza a “dialogar” adecuadamente con el citoplasma
    del óvulo y desencadena todo el complejo proceso del desarrollo
    intrauterino.

    1. Señala los términos incluidos en el texto que no podrías explicar bien lo
    que significan.
    2. Indica qué afirmaciones o argumentos no crees comprender bien.
    3. Selecciona una idea de cada párrafo que consideres relevante como
    síntesis de lo que expone.
    4. De las ideas que expresa el texto: ¿cuál o cuáles te sorprenden más?
    5. ¿Hay aspectos sobre los que te gustaría tener más información?
    6. ¿Qué crees haber aprendido al hacer este análisis?

    Tarea  "Clones"
       Vamos a poner un interesante documental en el que tratarás de contestar a las siguientes preguntas. Haremos paradas de 10' tiempo para corregirlas.

    1-¿Qué procedimientos de clonación hay?¿Cual defiende" Supermán"?
    2-¿Qué dice Vivianne sobre los hijos?
    3-¿Cómo llamamos a los clones naturales?
    4-¿Qué curiosa técnica emplea un investigador (Hans) para separar células de un embrión?
    5-¿Cuántas veces se hubo de repetir el experimento de clonar una oveja?¿Salió Dolly completamente sana?
    6¿De qué porcentaje sobre anormalidad humana se habla en el docu?
    7-¿Por qué no son idénticos los clones de la vaca del docu)
    8-¿Qué es una quimera?
    9-¿En qué año nació el primer clon de gato?¿Clonarías tu mascota muerta?
    10-Por qué desconfía algún científico de la clonación de animales (en vías de extinción)?

    Tarea 2 Leer el siguiente texto.

    4-El pasado 27 de marzo de 2015 se les concedió el Premio Princesa de Asturias de Investigación Científica y Técnica a una bioquímica francesa y a una bióloga molecular estadounidense. Estas dos investigadoras han desarrollado un método complejo para modificar las secuencias de ADN de prácticamente cualquier organismo. Esta técnica llamada CRISPR-Cas (en inglés: clustered regularly interspaced short palindromic repeats) no es la primera que consigue modificar el genoma de las células, pero su principal diferencia es que se trata de una herramienta barata, precisa y fácil de usar; su utilización es similar a la de un procesador de texto en el que se selecciona una frase y se añaden o suprimen caracteres.
    Sus aplicaciones van desde la mejora del rendimiento agrícola a la terapia génica o la modificación de cualquier característica en humanos (o cualquier otro ser).
    Hace tres años se sentaron las bases de este método y se ha avanzado mucho hasta el día de hoy, pero, a pesar de las múltiples investigaciones en la materia, los científicos advierten que no está listo para aplicarse en humanos porque no esta garantizado que sea totalmente seguro. Además, la ciencia tiene mucho que debatir con el gobierno y los comités éticos sobre la aplicación de estas técnicas en los seres vivos, ya que sus posibilidades van mucho más allá de lo que se pueda imaginar.
    1-De qué crees que va el texto.
    2-Qué opinas de la frase subrayada.

    Tareas para bachilleratos de humanidades.



    Tarea 1  BIOÉTICA

    ¿La ciencia es “buena” o “mala”? ¿Es importante  establecer límites éticos y morales al desarrollo tecnológico y científico? El concepto de Bioética es relativamente reciente.
    1.- ¿Qué es la Bioética?
    2.- ¿Cuáles son los cuatro principios fundamentales de la Bioética? Resúmelos.
    3.-Para que los de Humanidades se luzcan:
    Primum non nocere.
    ¿Qué significa esta frase latina? ¿A quién se le atribuye?
    4.- ¿Quién era Hipócrates? ¿Qué es el juramento hipocrático?
    5.- En el juramento hipocrático se hace referencia a Apolo el Médico, Esculapio, Hygeia y Panacea. ¿Quiénes eran estos personajes?
    6.- ¿Se sigue utilizando en la actualidad el juramento hipocrático, o ha sido sustituido por alguna otra fórmula?

    Tarea 2
    -La etnia de los judíos asquenazíes representan el 3% de la población y poseen el 30% de los premios Nóbel ,el 25% de los premios Turing y el 50% de los de ajedrez .Realiza una investigación y propón una explicación desde el punto de vista del neodarwinismo(selección natural + mutaciones).

    Tarea 3
    -Vas a representar el papel de un agente comercial, presentando una determinada empresa, y si tienes dotes, vender un producto.

      Puedes elegir entre las siguientes:

    -Mycovitro.
    -Genycell Biotech.
    -Lorgen.
    -Sistemas genómicos.
    -Genómica.
    -Labgenetics.
    -Syngenta.
    -Valentia.

       Para todos los bachilleratos

    Tarea 1 -El dopaje genético es el uso no terapéutico de la terapia génica para mejorar el rendimiento atlético. Esto se consigue mediante la introducción de un gen artificial en el cuerpo que modifica la expresión génica.
    El desarrollo de las terapias genéticas han hecho saltar las alarmas en el deporte, donde se puede abusar de ella, se denomina terapia génica a la transferencia de material genético por medio de vectores a determinados tejidos o células para el tratamiento o prevención de una enfermedad o trastorno.[
    A día de hoy son muchos los estudios sobre terapia génica. Los primeros fueron con la eritropoyetina (EPO) y la hormona del crecimiento (muy utilizadas en el doping convencional), por lo que vemos que terapia génica y deporte desde primer momento se encuentran estrechamente ligados.
    Actualmente esta transferencia de genes tiene unos resultados “inmaduros”, todavía se desconocen todos los problemas y riesgos.
        El Comité Olímpico Internacional tiene prohibido el dopaje genético desde 2003.
    a)      Busca algún caso sonado en la red describiendo los pasos que siguieron las autoridades para descubrirlo.



















    Docu de 50' Dopaje genético.
    Cuestiones:
    1-¿En qué parte de la célula realiza su función el ARN?
    2-¿Qué hace la hormona eritropoyetina?
    3-¿Cuál es el gen, cuya mutación, es la responsable de los "bebes culturistas"
    4-¿Qué  "vehículo" se utiliza para introducir genes en un individuo?
    5-¿Qué es el dilema de Goldman?
    6-¿Qué esperanza de vida tienen los afectados por distrofia muscular de Duchenne?
    7-¿Cuál fue el primer tipo de enfermedades en las que se intentó la terapia génica?




    Tarea 2- El cariotipo humano y las mutaciones genómicas.
       Se define cariotipo como el conjunto de cromososmas(nº,forma,tamaño) que caracteriza a un individuo.Las mutaciones genómicas son aquellas en las que se afecta el nº  o juegos de cromosomas.

    Ejemplo de cariotipo humano:


      A partir de esta introducción haz las actividades de este enlace

    Una vez hechas contesta a las siguientes preguntas:
    a) Qué término se utiliza para designar las mutaciones genómicas en las que varía el juego de cromosomas.Cuantos juegos tendrá un ser vivo tetraploide?
    b)  Qué término se utiliza para designar las mutaciones genómicas que a fectan a los animales como los seres humanos?

    3-Anális del material genético
        

        Busca el cromosoma donde está la hemofilia en esta  página de la web del Human Genome  pulsando sobre él con el botón derecho del ratón podrás aumentarlo de tamaño hasta que puedas leer el nombre de la enfermedad; bajando hacia abajo llegarás a la localización aproximada de los genes responsables de la hemofilia. Según bajas verás muchas otras enfermedades que, por el hecho de estar en el cromosoma X, van a afectar de forma diferente a mujeres y hombres. 

      Voluntario:
    Entra en la web de la Federación Española de Hemofilia pulsa en el apartado "¿Qué es la hemofilia?" y podrás leer una explicación sobre las causas de esta enfermedad, y la diferencia entre el tipo A y el B. En esta otra página de la web puedes ver cómo se distribuye la enfermedad entre las casas reales emparentadas con la reina Victoria de Inglaterra, entre ellas la española. 

    tarea 6-Alimentos transgénicos




     Tareas para el bachillerato de ciencias y/o tecnológico


    Pregunta 1:

    La clave de la transgénesis, la obtención de un organismo genéticamente modificado, está en extraer genes de interés de un organismo e introducirlos en otro, de modo de obtener un producto con características mejoradas. Pero ¿cómo se hace para "cortar" ADN de un organismo e insertarlo en otro? Los genetistas necesitaban herramientas para hacerlo, y así descubrieron las enzimas de restricción, las “tijeras moleculares” que cortan el ADN. De esta forma, es posible extraerlo del genoma de un organismo. También descubrieron las enzimas ligasas que "pegan" el fragmento de ADN aislado dentro del ADN del nuevo organismo. 

    La siguiente secuencia corresponde a una molécula de ADN de cadena doble de un determinado organismo:
      
       5´ ------------------------------------------------------------------------------------- 3´
            A   T   G   A    A   T    T   C   G   A   A   G   C   T    T   G
            T   A   C   T    T    A   A   G   C   T   T   C   G   A   A   C
       3´ ------------------------------------------------------------------------------------- 5´

      Consultando la tabla siguiente, contesta a las cuestiones:


    a) ¿Qué fragmentos de restricción se originarán tras la incubación de la molécula de ADN con la endonucleasa de restricción EcoRI?
    b) ¿Y si se utiliza Hind III?

    Pregunta 2:
    ¿Existe alguna relación entre la secuencia de bases de una cadena de ADN, la secuencia de bases de una molécula de ARNm y la secuencia de aminoácidos de una proteína?¿Qué dos palabras se pueden usar para responder a a la última pregunta?
    Pregunta 4:


    Pregunta 5:
    La biotecnología actual permite crear copias de animales gracias a una técnica que se conoce como:

    a) Duplicación.
    b) Transgénesis.
    c) Clonación.

    Pregunta 6:
    Una parte del genoma humano no tienen función conocida y representa el:

    a) 95% del genoma.
    b) 33,5% del genoma.
    c) 99,99% del genoma.

    Pregunta 7:
    Cualquier molécula de ADN formada por la unión de segmentos de ADN de origen diferente es:

    a) ADN basura.
    b) ADN recombinante.
    c) ADN complementario.

    Pregunta 8:
    ¿Sabrías explicar qué es un animal knockouty para que se diseñan?
    Pregunta 9:
    El sida y la “enfermedad de las vacas locas” nos han demostrado lo fácil que es para las enfermedades saltar de una especie a otra, con gravísimas consecuencias.
    Si trasplantar un corazón de cerdo transgénico a una persona, posiblemente, sería un éxito, ¿por qué crees que aún no se ha realizado esta operación?

    Pregunta 10:
    Construye las dos cadenas de ADN del cual se obtuvo por un proceso de transcripción la siguiente secuencia de ARN:
          
    AUGCCUAGGCUCAAUACGGUGA


    Test 


    1- Qúe es un gen: a) Un fragmento de ADN.b)Unidad de información en el material genético c) Las dos son correctas.
    2- ¿Qué es la eugenesia?

    a)Es el conjunto de técnicas encaminadas a mejorar la naturaleza de la especie humana.b)Es la ciencia de los genes c)Es la falsa ciencia de los genes
    3.¿Mediante que proceso se lleva a cabo la clonación natural del ADN?
    A) Mitosis B) Reproducción sexual C) Replicación.

    4.¿Qué tipo de clonación busca poder curar enfermedades o reemplazar órganos?
    A) Terapeútica B) Reproductiva C) Curativa
    5.¿Qué macromolécula es sintetizada y que enzima intervienen en el proceso de transcripción?
    A) ADN y ADN polimerasaB) ARNm y ARN polimerasa C) ADN y ARN 

    6. ¿Qué es un alelo?a) Cada uno de los genes que, situados en el mismo lugar de los cromosomas homólogos , regulan la misma función. b)  ARN tomando como molde  una hebra de ADN.c) Un atonto.

    7. ¿Qué es la terapia génica?a) Es el proceso por el cual se sintetizan dos copias idénticas de ADN tomando como modelo otra cadena de ADN. b)  Clonación humana con fines terapeúticos. c) Consiste en modificar los genes anómalos para impedir que se manifieste una enfermedad o para curarla una vez manifestada.

    8. ¿Qué es la bioética ?a) Disciplina basada en los valores y principios morales  que han de regir la conducta humana en temas sobre biología .b) Son los principios de no maleficiencia y de justicia.c) La moral biológica .
    9. ¿Qué dos tipos de células madre existen?a) troncales y somáticas b) de gran salto y troncales.c)embrionarias y de gran salto.
    10. ¿Qué es un embarazo ectópico ?a) Un embarazo corriente. b. Un embarazo fuera del útero c) a y b son falsas.

    11. ¿Qué es el/la cápside/a?a) Envoltura proteica que rodea un virus. b) Piel que recubre los dedos de los pies.c)  Envoltura proteica que rodea una bacteria.
    12.¿Quiénes obtuvieron el premio nobel por el descubrimiento de la estructura del ADN?a) Watson y Crick.b) Crick y Franklin.c) Watson y Franklin.
    Rosalind Franklin obtiene la 1ª "mágen" del ADN.



    12'-¿Quién descubrió los cromosomas sexuales?: a) Walter Flemming(1900) b) Walter Sutton(1902) c)Nettie Stevens(1905).



    13-¿Qué proceso se encarga del paso de ARNm a ADN?a) Retrotranscripción o trascripción inversa.b) Replicación.c) Traducción

    Descubridor de la retrotranscriptasa.


    14-¿Cuál de estas es la definición de gen?
    a) Es  una secuencia determinada de nucleótidos.(fragmento de ADN). 
    b) Es todo el material genético contenido en las células de un organismo en particular.
    c) Es cada uno de los pequeños cuerpos en forma de bastoncillos en que se organiza la cromatina del núcleo celular durante las divisiones celulares (mitosis y meiosis).


    14'-¿Quién descubrió los genes saltarines? a)Thomas Morgan(1910) b)Barbara McClintoch c)Tatum y Beadle



    15-¿Cuál de estas es la definición de genoma?
    a) Es todo el material genético contenido en las células de un organismo/especie en particular.
    b) Es el conjunto de una secuencia determinada de nucleótidos de uno de los lados de la escalera del cromosoma referenciado.
    c) Es cada uno de los pequeños cuerpos en forma de bastoncillos en que se organiza la cromatina del núcleo celular durante las divisiones celulares (mitosis y meiosis).
    16-¿Cuál de estas es la definición de cromosoma?
    a) Es cada uno de los pequeños cuerpos en forma de bastoncillos en que se organiza la cromatina del núcleo celular durante las divisiones celulares (mitosis y meiosis).
    b) Es el conjunto de una secuencia determinada de nucleótidos de uno de los lados de la escalera del cromosoma referenciado.
    c) Es todo el material genético contenido en las células de un organismo en particular.
    17-De los conceptos siguientes ¿Cuál alude al nivel de complejidad  más sencillo?a) Gen b) Cromosoma c) Célula.
    17'-¿Qué es el código genético? a) Un conjunto de normas que obedecen los genes b) La correspondencia entre la información de los genes y su traducción a proteínas c) Las leyes de la herencia


    18-Quien realizo la primera clonación en mamíferos a partir de células diferenciadas?:a) Ian Wilmut. b) Francis Crick. c)James  Watson.(Ya a finales del s., XIX se trasfieren los primeros embriones de conejo y mediados del XX 1ª clonación a partir de células embrionarias)

    19- ¿En que año nació la primera niña probeta?a) 1978. b) 1979. c) 1977.(tb es el año en que se identifica el 1er gen humano).
    Desde entonces han nacido más de 5 millones de niños.

    21- Los niños probeta son concebidos mediante:A- Inseminación artificial.B- Fecundación in Vitro.C- Clonación.(De mediados del s.XX  son las I.A )
    1997 nacen los clónicos Neti y Ditto
    22-¿Cuándo es descifrado por completo el genoma humano? A- 1993.B- 2001 C- 2003.
    23- Los seres humanos tenemos en nuestras células.A- 46000 genes y 23 autosomas.B- 25000 genes y 44 autosomas.C- 25000 genes y 46 cromosomas sexuales.
    24¿Quién fue Mendel? A- Descubridor de las leyes de la herencia.B- Padre de la biología molecular.C- Enunciador de la teoría de la evolución de las especies.


    25-¿Qué quiere decir ADN basura? A- ADN que se ha producido por la multiplicación bacteriana.B- ADN sin actividad biológica.C- ADN del que se sospechan funciones aún no enteramente conocidas.
    26-¿Qué son las células somáticas? A- Son las reproductoras o geminativas.B-Todas células de un ser vivo exceptuando las anteriores.C- Las llamadas células madre.
    27- ¿Qué puede obtenerse con los animales transgénicos ?A- órganos de trasplante a los humanos.B-Fármacos.C- A y B son correctas.





     Docu "La granja del Dr. Frankenstein" 101'

    28¿ Qué es un nucleótido?A) Son los componentes de los ácidos nucléicos. B) Son moléculas orgánicas formadas por la unión covalente de un monosacárido de cinco carbonos , una base nitrogenada y un grupo fosfato.C) A y B.

    29-¿Qué es el ADN recombinante?A) Moléculas que son sintetizadas por bacterias para proteger su ADN de otro ADN invasor.B) Molécula de ADN formada por la union de segmentos de ADN de origen diferente.C) Moléculas que unen distintos fragmentos de ADN pegando sus extremos.


    30-¿En qué campos aplicamos la biotecnología?
    A) Medicina e industria.B) Medio ambiente, agricultura y ganadería.C)Todas las opciones anteriores son correctas.






    31-¿Cual es la función de las enzimas de restricción?
    A)Funcionan como tijeras químicas que cortan el ADN extraño en fragmentos cuyos extremos pueden unirse con el extremo de otro fragmento de ADN.
    B) Permiten mantener y crecer "in vitro" células,órganos y embriones durante largos periodos de tiempo.
    C) Funcionan como reparadoras del tejido y óganos adultos dañados o defectuosos.
    Hamilton Smith.P.N por su descubrimiento.
    CCBB
    CS,CD,CMCT

    ¿Qué es CRISPR?¿ y Francisco Mojica?
    32- ¿Cuáles son las bases nitrogenadas del ADN?a) ATDG.b) ANDG.c) ATCG
    33-¿Cuántos cromosomas tienen las células somáticas de un individuo?A- 46 B- 44 C- 48
    34- ¿Qué enzima interviene en la trascripción?A- ADN polimerasa.B- transcriptasa inversa.C- ARN polimerasa
    35-¿Qué significa PGH?A- Proyecto genoma humano. B- Proyecto gen humano C- Proyecto humano genómico


    Descubren los genes discontinuos.Intrones y exones.

    36- Cual seria la reproducción asistida que aplicarías en una pareja en la que no hay causa de esterilidad:A- Inseminación artificial B- Estimulación ovárica y sexualidad dirigida C- Transferencia de embriones donados.


    37.¿Cuántas células se formaran después de 10 mitosis sucesivas sufridas por el cigoto a) 1024 (2exp10) b) 20.c) ninguna de las anteriores es correcta.


    38- Hormona obtenida mediante la tecnología del ADN a) Antibiótico b) antitripsina c) insulina.


    40- Al conjunto de 3 nucleótidos que codifican un aminoácido se les llama: a) Transcriptasa b) Codón. c) Intrón.

    41.¿Cuáles son los tipos de mutaciones que existen?a) Genéticas ,cromosómicas y numéricasb) Génicas cromosómicas y numéricas.c) Genéticas cromosómicas y anuméricas.


    Doc Cromosoma cinco RTVE


    42. ¿Cuáles son los tipos de ARN?a) Mensajero, viajero y ribosomal.b) Mensajero, transferente y ribosomal.c) Mensajero, viajero y transferente.

    42. ¿Qué forma tiene la estructura del ADN y de que esta formada?a) Doble hélice, formada por nucleótidos de Adenina Guanina Citosina y Uracilo.b) Circular, formada por nucleótidos de Adenina Guanina Citosina Timina y Uraciloc) Doble hélice, formada por nucleótidos de Adenina Guanina Citosina y Timina


    43. Tipo de fecundación basada en una unión del óvulo y espermatozoide en un laboratorio…
    a) Fecundación en Vitro.b) Fecundación in Vitro.c) Fecundación in Votrio.d) Bodrio de fecundación.


    44. La ley de Repredución Humana Asistida permite la transferencia al útero de: A- Hasta tres embriones B- No existe esta ley C- No hay límite.


    46.¿Qué células tienen capacidad de multiplicarse, desarrollarse, y diferenciarse dando lugar a células de otros tejidos? A- Células madre.B- Células hembra.C- Células padre.


    47.El proceso de síntesis de proteinas se denomina:a) replicacion.b) traduccion.c) transcripcion.


    48.La clonación humana con fines reproductivos.a) Está prohibida y no cuenta con el apoyo de la comunidad cientifica.b) Es eugenesia.c) Sólo es legal en algunos paises.


    Una técnica de reproducción asistida utiliza el ADN de dos madres y de un padre

    03 feb 2015



    49- La reacción en cadena de polimerasa(PCR) permite:a) obtener millones de copias de un segmento especifico de ADN mediante un proceso denominado transformacion.b) obtener millones de copias de un segmento de ADN mediante repeticion de multiples ciclos de replicacion de ADN in vitroc) obtener millones de copias de un segmento especifico de ADN mediante biblioteca o genotecas de ADN.



    Kary Banks Mullis.Inventa la técnica de la PCR.

    49'-¿Cuándo se aplica por primera vea la prueba del ADN en un juicio?
    a) 1970 b) 1980 c) 1985.
    50-¿Cuántos aminoácidos diferentes  forman  las proteínas?a) 25.b) 30.c) 20.
    52. ¿Qué es una enzima?
    a) Es un tipo de proteína que hace posible una reacción química y ésta reacción determina un/os carácter/es en un ser vivo.b) Es un nucleótido.c) Es un fragmento de ADN.
    53.¿Qué porcentaje del genoma está formado por ADN basura? A- 95%.B- 50%.C- 5%
    55.¿Como se llama al proceso para obtener células madre a partir de celulas adultas?:a)Diferenciación.b)Reimplatación.c)Reprogramación.


    56.¿De qué se ocupa el Proyecto Genoma Humano? : a)De la clonación de partes del ADN humano con fines terapéuticos .b)De la secuenciación de la totalidad de la información genética del ser humano .c)De la síntesis de genes humanos en laboratorio.



    Desarrolla el primer método de secuenciación del ADN.

    57. La ingeniería genética se define como:a) La ciencia biológica que trata de la manipulación de los genes.b) La tecnología de la manipulación y transferencia de ADN de un organismo a otro, que posibilita la creación de nuevas especies.c) Una parte de la biotecnología que se basa en la manipulación genética de organismos con un propósito predeterminado, aprovechable por el hombre.d) Todas las anteriores son ciertas.
    58. Son aplicaciones de la ingeniería genética :a) Obtención de proteínas de interés médico y económico como antibióticos , enzimas, hormonas…b) Mejora de animales y vegetales para obtener una mayor producción y mejor calidad.c) Biodegradación de residuos. d)Tratamiento de enfermedades como algunos cánceres, hemofilia, diabetes, sida…e) Todas.
    59. Son riesgos de la Ingeniería Genética :a) Productos de consumo humano poco experimentados sobre sus posibles consecuencias para nuestra salud. b) Monopolización de la información con la intervención de grandes multinacionales farmacéuticas y químicas y explotación de recursos del tercer mundo.c) Peligro de manipular virus y bacterias patógenos .d)Todas las anteriores. 




    Docu "somos lo que comemos 43'

    Cuestiones:
    1-¿Qué problema tienen los indios emigrantes a Gran Bretaña referente a su alimentación vegetariana?
    2-¿Qué producto consumen los japoneses que reduce la incidencia de cáncer?
    3-¿Qué aconteciminto fué el responsable de que en China en los años 70 hubiera más casos de esquizofrenia?
    4-¿Qué alimento tubo que importar la reina Catalina de Medicis para aumentar la supervivencia de sus hijos?
    5-¿Qué sustancia se encuentra en los biberones que es perjudicial para la salud?
    6-Nombra tres alimentos que ayuden a reducir la probabilidad de tener ciertos cánceres.


    60.La epigenética es:a) Parte de la genética que estudia la superficie en la herencia de los caracteres.b)  Parte de la genética que estudia los factores ambientales en la herencia de los caracteres.c) Parte de la genética que estudia el comportamiento en la herencia de los caracteres.


                              



    Otro docu sobre epigenética 53'

    Cuestiones:
    1-Cómo se llama a la genética que simplemente predice la transmisión de genes?
    2-Cómo se llaman a los niños con síndrome de Engelman?
    3-que tienen en común los síndromes de Prader-Bilig y de Engelman?
    4-Cuál era el objetivo del Proyecto Genoma Humano?
    5-Qué es la impronta genética?
    6- Cómo se llama a la ciencia que estudia la activación y desactivación de los genes?
    7-Podemos decir que las marcas epigenéticas se heredan, pon un ejemplo?
    8-Cómo explicarías según  este documental porque tú generación en general es más alta que la de tus padres.

    61-Es lo mismo la nutrigenómica que la nutrigenética: a) No,ya que mientras que la primera estudia la interacción de los nutrientes sobre el material genético la segunda estudia como ciertos genes propiciarán como tal o cual nutriente afecte a la salud de un individuo b) Sí , ya que genómica y genética son términos homólogos. c) Ninguna de las anteriores.

      Práctica de laboratorio: extracción del ADN.



    SECCIÓN CURIOSIDADES

    El coywolf es un híbrido entre coyote, lobo y perro.
    SECCIÓN PERSONAJES




    SECCIÓN VIDA DE PELÍCULA



      Enlazando un bloque con otro:

       Alan Turing muere a la edad de 41 años tras dos años de penoso periplo. Murió trabajando en el concepto de morfogénesis , aunando los campos de la genética y las entonces tecnologías de la información.



       Actividad de inicio de bloque:

       Investiga la vida de Alan turing, después elige un tema de interés relacionado con ella.


    Bloque 5. Nuevas tecnologías en comunicación e información

     

    Criterios de evaluación

    1. Conocer la evolución que ha experimentado la informática, desde los primeros prototipos
    hasta  los  modelos  más  actuales,  siendo  consciente  del  avance  logrado  en  parámetros  tales
    como tamaño, capacidad de proceso, almacenamiento, conectividad, portabilidad, etc.
    2.  Determinar  el  fundamento  de  algunos  de  los  avances  más  significativos  de  la  tecnología
    actual.
    3.  Tomar  conciencia  de  los  beneficios  y  problemas  que  puede  originar  el  constante  avance
    tecnológico.
    4. Valorar, de  forma crítica y  fundamentada, los cambios que internet está provocando en la
    sociedad.
    5.  Efectuar  valoraciones  críticas,  mediante  exposiciones  y  debates,  acerca  de  problemas
    relacionados  con  los  delitos  informáticos,  el  acceso  a  datos  personales,  los  problemas  de
    socialización o de excesiva dependencia que puede causar su uso.
    6.  Demostrar  mediante  la  participación  en  debates,  elaboración  de  redacciones  y/o
    comentarios  de  texto,  que  se  es  consciente  de  la  importancia  que  tienen  las  nuevas
    tecnologías en la sociedad actual.

    Estándares de aprendizaje evaluables

    1.1.  Reconoce  la  evolución  histórica  del  ordenador  en  términos  de  tamaño  y  capacidad  de
    proceso.
    1.2. Explica cómo se almacena la información en diferentes formatos físicos, tales como discos
    duros,  discos  ópticos  y  memorias,  valorando  las  ventajas  e  inconvenientes  de  cada  uno  de
    ellos.
    1.3. Utiliza con propiedad conceptos específicamente asociados al uso de Internet.
    2.1.  Compara  las  prestaciones  de  dos  dispositivos  dados  del  mismo  tipo,  uno  basado  en  la
    tecnología analógica y otro en la digital.
    2.2.  Explica  cómo  se  establece  la  posición  sobre  la  superficie  terrestre  con  la  información
    recibida de los sistemas de satélites GPS o GLONASS.
    2.3. Establece y describe la infraestructura básica que requiere el uso de la telefonía móvil.
    2.4. Explica el fundamento físico de la tecnología LED y las ventajas que supone su aplicación
    en pantallas planas e iluminación.
    2.5.  Conoce  y  describe  las  especificaciones  de  los  últimos  dispositivos,  valorando  las
    posibilidades que pueden ofrecer al usuario.
    3.1. Valora de forma crítica la constante evolución tecnológica y el consumismo que origina en
    la sociedad.
    4.1. Justifica el uso de las redes sociales, señalando las ventajas que ofrecen y los riesgos que
    suponen.
    4.2. Determina los problemas a los que se enfrenta Internet y las soluciones que se barajan.
    5.1. Describe en qué consisten los delitos informáticos más habituales.
    5.2. Pone de manifiesto la necesidad de proteger los datos mediante encriptación, contraseña,
    etc.

    6.1. Señala las implicaciones sociales del desarrollo tecnológico.


         Las tareas y test que se exponen a continuación están relacionadas enteramente con los criterios de evaluación.

    Concepto de TIC• Según el Plan Nacional de Tecnologías de laInformación y las Comunicaciones, las“Tecnologías de la Inform...


            La Evolución de Las Tecnologías de Información




      Las telecomunicaciones surgen de manera aproximativa a raíz de la invención del telégrafo (1833) y el posterior despliegue de redes telegráficas por la geografía nacional, que en España se desarrolla entre los años 1850 y 1900.
      Otros hitos y hechos importantes que han marcado la evolución de las telecomunicaciones son:

    . 1871 Antonio Meucci inventa el" teletrófono", llamado después teléfono.

    · 1876 (10 de marzo): Grahan Bell patenta el teléfono, en Boston, mientras Thomas Watson construye el primer aparato.
    .1897 Marconi patentó la radio, aunque solo en un país y utilizando para su realización diecisiete patentes de Nikola Tesla, . En años posteriores dicha paternidad fue disputada por varias personas.

      1926 Nace la televisión.
    90.º aniversario de la primera demostración de la televisión
    Este año,2016 se cumple el 90 aniversario de la primera emisión de T.V,Jhon Logie Baird fué el inventor .

    ·                                                      El primer programa de televisión

     1927 (11 de Enero): Se realiza la primera transmisión de radiotelefonía de larga distancia, entre USA y el Reino Unido, a cargo de AT&T y la British Postal Office.

    · 1948 (1 de Julio): Tres ingenieros de Bell Laboratories inventaron el transistor, lo cual, supuso un avance fundamental para toda la industria de telefonía y comunicaciones.


    -
    Ganador en dos ocasiones del nòbel de física (transistor y superconductores).


    · 1951 (17 de Agosto): Comienza a operar el primer sistema transcontinental de microondas, entre Nueva York y San Francisco.

    · 1956 (a lo largo del año): Comienza a instalarse el primer cable telefónico trasatlántico.

    · 1963 (10 de Noviembre): Se instala la primera central pública telefónica, en USA, con componentes electrónicos e incluso parcialmente digital.

    · 1965 (11 de Abril): En Succasunna, USA, se llega a instalar la primera oficina informatizada, lo cual, sin duda, constituyó el nacimiento del desarrollo informático.
    -1969  Nace Internet
    - 1984 (1 de Enero): Por resolución judicial, la compañía AT&T se divide en siete proveedores (the Baby Bells), lo que significó el comienzo de la liberación del segmento de operadores de telecomunicaciones, a nivel mundial, el cual progresivamente se ha ido materializando hasta nuestros días.
     
    Desde 1995 hasta el momento actual los equipos han ido incorporando tecnología digital , lo cual ha posibilitado todo el cambio y nuevas tendencias a las que asistimos. Se abandona la transmisión analógica y nace la Modulación por Impulsos Codificados o, lo que es lo mismo, la frecuencia inestable se convierte en código binario, estableciendo los datos como único elemento de comunicación.
        Ya se dejaron atrás las válvulas de vacío,se crearon los sistemas operativos,microprocesadores,chips microchips etc.


       Y dónde estamos ahora...

    Robohon el robot humanoide de bolsillo que espera revolucionar la telefonía móvil.









    Baila, charla, y además funciona como un móvil muy sofisticado. En unos dos meses podría empezar a comercializarse en Japón. El dispositivo busca revolucionar la clásica interfaz de los teléfonos móviles, de los cuales critican su formato: prácticamente obsoleto y "poco amigable". Este androide mide 19,5 centímetros y pesa sólo 390 gramos de peso; está dotado de tecnología de reconocimiento facial y de voz para "humanizarlo". Su batería puede durar en torno a un día, tiene una pequeña pantalla táctil para navegar en internet y permite conectividad 4G, además de wifi y Bluetooth.


                                                                                                                               13.03.2016


    ¿Que es un Sistema Operativo?

     
       


                 ¿Como se fabrican los circuitos integrados?



    Top 10 de los avances tecnológicos más importantes de 2014






    Tareas para el  Bachillerato de letras. 

    1-Lee el siguiente texto,reflexiona sobre lo subrayado y fundamenta tu acuerdo o desacuerdo.

    INTERNET HA REDUCIDO EL COLONIALISMO CULTURAL
    Eduardo Galeano

       Internet, por ejemplo. Aquello que nació al servicio de las programaciones de las operaciones internacionales en EEUU está siendo ahora un instrumento de vida. Sirve para dar voz a quienes antes estaban condenados a la soledad. Por mi parte, confieso que al principio desconfiaba de todo esto: pensaba que las máquinas beben de noche. Que cuando nadie las ve se emborrachan y por eso durante el día hacen cosas inexplicables. No hay que olvidar, sin embargo, que la globalización implica concebir la codicia como motor de la vida, el arréglate como puedas, y quien no, que se joda. (Eduardo Galeano, 2009)




    2-Lee el siguiente texto conformado por trocitos de la biografía de McLuhan extraídos de la wikipedia y responde a las actividades.

    Herbert Marshall McLuhan (21 de julio de1911  31 de diciembre de1980) fue un filósofoerudito y educador canadiense. En la Universidad de Manitoba (Canadá) estudió la Licenciatura en Letras y la Maestría en Artes. Se doctoró a los 31 años de edad en la Universidad de Cambridge. Un total de nueve universidades le concedieron doctorados honoris causa:University of Windsor (1965), Assumption University (1966), University of Manitoba (1967), Simon Fraser University (1967), Grinnell University(1967), St. John Fisher College (1969), University of Alberta (1971),University of Western Ontario (1972), University of Toronto (1977).
    McLuhan saltó a la fama en 1964, cuando publicó Understanding Media. El libro, sin recursos publicitarios, se trasformó en un best seller en Harvard y otras universidades.
    Profesor de literatura inglesa, crítica literaria y teoría de la comunicación, McLuhan es reconocido como uno de los fundadores de los estudios sobre los medios, y ha pasado a la posteridad como uno de los grandes visionarios de la presente y futura sociedad de la información. Durante el final de los años 60 y principios de los 70, McLuhan acuñó el término aldea global para describir la interconexión humana a escala global generada por los medios electrónicos de comunicación. Es famosa su sentencia "el medio es el mensaje".
    ……………………………………………………
    Su lápida reza, con tipografía digital:
    La verdad nos hará libres. 
    Diarios y revistas lo recordaron a su muerte con calificativos como Místico de la Aldea Electrónica o El más hippie entre los académicos y el más académico entre los hippies.

    1-      Busca el significado de las palabras subrayadas y luego añade una definición hecha con palabras originales y adaptadas a la actualidad.
    2-      ¿Cuáles son las universidades más prestigiosas del mundo? P.E. las 5 primeras.¿Cuáles son las condiciones de admisión? ¿Y en España?
    3-      Apréndete de memoria la definición de “aldea global” dada por el texto, crea la tuya propia y apréndetela también. Díme en la próxima clase la que mejor recuerdes.
    4-      Qué crees significa la sentencia “el medio es el mensaje”.

       Tarea 3 

        ¿Sabes qué es la nomofobia?
        ¿Crees que eres nomofóbico?. Qué condición no cumples.
       ¿ Cuál de los siguientes vídeos refleja mejor esta patología?
                                        





    video
       
                                           TECNOLOGÍA  LED


    Los LEDs o diodos de emisión de luz siempre se han utilizado en el mundo de la tecnología como indicadores lumínicos, ya que son dispositivos semiconductores que emiten luz cuando por el circula una corriente eléctrica. La tecnología LED ha dado su paso más reciente con los LEDs de luz blanca que son los que pueden sustituir a las bombillas de luz, principalmente porque consumen menos energía eléctrica la cual se enfoca al cuidado del medio ambiente. En cuanto a las pantallas LED, hay varios modelos de LEDs distintos como los OLED (led orgánicos) que están fabricados con materiales polímeros orgánicos semiconductores, que si bien no tienen la misma eficiencia, son aun mucho más baratos de fabricar y mejores para el medio ambiente.
      Los LEDs (diodo emisor de luz) pasan a un primer plano ya que su consumo de potencia es aproximado a un 40% menos que las lámparas tradicionales. La tecnología LED y OLED se está empleado en la gama de televisores haciéndoles más nítidas las imágenes y menos volumen en su diseño, en semáforos haciéndoles a estos que consuman menos potencia y sean más visibles y duraderos que los semáforos normales. Los LEDs actualmente disponibles ya están reemplazando rápidamente a otras fuentes de iluminación como así también son hoy la tecnología preferida para luces decorativas y de diferentes aplicaciones. La potencia de los LEDs, como fuente de iluminación general (luz blanca), es actualmente una de sus principales promesas de cara al futuro. 


         
       TRABAJEMOS LAS COMPETENCIAS CLAVE:CA,CD...

        Busca en tu casa algún aparato o dispositivo que utilice estas tecnología,hazle una foto y explica cual es su función.


                                   Viral 

    La promoción de una marca es posible sin que  sean imprescindibles unos presupuestos de marketing y publicidad astronómicos. “Gracias al mundo digital las pymes pueden medir sus marcas con las de las multinacionales,sólo con  un vídeo viral.
    Tarea 4:

       ¿Serías capaz de intentarlo?
    1- Expón esa idea que llevas dentro y no tienes tiempo para realizarla(obviamente puedes dar paso a la imaginación)
    2- Dínos "cuál es tu video víral" y el motivo.
       

                                         EXHIBICIONISMO EN LA RED
    Compartir lo que pensamos y hacemos no es perjudicial, sino que ayuda a los individuos a tener una vida más plena y con mayores posibilidades de progreso. 
    Eso sí, matiza su opinión: «Antes de exhibir algo se debe hacer una reflexión previa». Pero, ¿todo el mundo piensa antes de pulsar el botón de ‘publicar’?Según Tascón, ahí reside el problema de los ‘compartidores compulsivos’. «La gente no es consciente de que una vez publica algo, esos datos dejan de ser exclusivamente suyos», apunta.
    Docu de 54'

    Tarea 5 (Para un crupo de CC)

      Contesta a las siguientes cuestiones (preparadas según disponga el profesor)
     -¿Qué es un freelance?
     -¿Qué es el timo del prisionero?

    Tarea 6 (Para otro grupo)

    Ver el  vídeo  En las profundidades de la web 50' y contesta a las siguientes cuestiones (preparadas según disponga el profesor)
    -¿Cómo se llama la tecnología que ofrece la posibilidad de conectar los aparatos o mecanismos de nuestra casa con internet?
    -¿Qué es GCHQ en el documental?
    -¿En dónde se concentraentra el 25% de tráfico de datos de internet?
    -¿Cada qué longitud de cable de fibra óptica es nesesario "reforzar la señal"? 
    -¿Quién es el inventor de la worl wide web ?
    -¿Cuales son las fases de la vigilancia que  nos hacen?

    Tarea fin de bloque


    Después de ver el siguiente esquema de contenidos elige uno y prepara un ppt


    TEORÍA
    Test correspondiente al bloque Aldea Global.

     ¿A ver si lo sabes?
    - ¿En qué consiste el proyecto Loon de gogle?
    a) Extensión de la red  en la luna .
    b) Extensión de la red a la sabana africana.
    c) Extensión de la red mediante una serie de globos
    -En qué porcentaje se estima que la gente se empareja gracias a las web:
    a)10%
    b)20%.
    c)30%
    -Debe distinguirse entre dato e información. Dato es cualquier número, imagen, sonido, símbolo, nombre, etc que no permite tomar ninguna decisión, porque no tienen un significado concreto, los datos deben procesarse para dotarlos de significado y convertirlos en información.Esta se puede representar anivel físico o lógico.

       A nivel lógico el ordenador, para poder procesar los distintos datos, debe convertirlos a un lenguaje numérico binario (0 y 1). Así para convertir los textos en números se utiliza un código de representación llamado:
    a)Ean.
    b)ASCII
    c)QR.
    1) Qué es un byte (equivale a 8 bits,bit= binary digit):
    a) Es una unidad de información utilizada por las computadoras.
    b) Es una unidad de medida para calibrar la información en Internet
    c) Es un tipo de datos de almacenamiento

    2) ¿A cuánto equivale un Kilobyte (KB)?
    a) Equivale a 1024 bits         b) Equivale a 1024 bytes.     c) Equivale a 1024 megabytes
    3)¿Qué es un módem?
    a) Dispositivo modulador-demodulador de señales digitales.
    b) Dispositivo moderno que envía señales analógicas
    c) Conjunto de chips sensibles a la luz
    4) Se define formato de archivo informático como:
    a) Estructura usada para grabar datos en un fichero.
     b) Forma particular de codificar información.
    c)Los dos anteriores
    5)Son formatos de almacenamiento de imágenes sin compresión:
    a)RAW
    b)DNG
    c)Las dos anteriores.
    6) Se define extensión de archivo informático como:
    a) Es una cadena de caracteres anexada al nombre de un archivo, usualmente precedida por un punto. Su función principal es diferenciar el contenido del archivo de modo que el sistema operativo disponga el procedimiento necesario para ejecutarlo o interpretarlo.
    b) Describe una especificación desarrollada en software, hardware o una combinación de ambos, capaz de transformar un archivo con un flujo de datos (stream) o una señal
    c) Estructura usada para grabar datos en un fichero

    7) Se define códec(compresión-descompresión) como:
    a) Es un programa de ordenador que es capaz de disminuir el tamaño de largos archivos de películas, y hacer que se puedan reproducir en tu ordenador.
    b) Programas que utilizan cálculos numéricos(y algoritmos) para comprimir un archivo de audio o video al grabarlo o descomprimirlo al reproducirlo,es un codificador -decodificador.
    c) a y b son correctos..


    8)No son ejemplos de códecs:
    a)Divx o Xvid
    b)MP3,Wma,etc
    c)Avi..
    9) ¿Qué es la RAM(random acces memory)?
    a) Es una memoria volátil de escritura y lectura, se utiliza como almacén temporal de datos. No se borra cuando se apaga el equipo.
    b) Es una memoria volátil sólo de lectura, se utiliza como almacén temporal de datos. No se borra cuando se apaga el equipo.
    c) Es una memoria volátil de escritura y lectura, se utiliza como almacén temporal de datos. Se borra cuando se apaga el equipo
    10) ¿Qué es la ROM?
    a) Es una memoria volátil de escritura y lectura, se utiliza como almacén temporal de datos. No se borra cuando se apaga el equipo.
    b) Es una memoria volátil de escritura y lectura, se utiliza como almacén temporal de datos. Se borra cuando se apaga el equipo.
    c) Es una memoria volátil sólo de lectura, se utiliza como almacén temporal de datos. No se borra cuando se apaga el equipo
    11) ¿Qué es la EPROM?
    a) Es una memoria volátil sólo de lectura, se utiliza como almacén temporal de datos. No se borra cuando se apaga el equipo
    b) Es una memoria volátil de escritura y lectura, se utiliza como almacén temporal de datos. No se borra cuando se apaga el equipo.
    c) Es una memoria volátil de escritura y lectura, se utiliza como almacén temporal de datos. Se borra cuando se apaga el equipo
    12) ¿Qué es la BIOS?
    a) Es un conjunto de rutinas básicas que se almacenan en memoria ROM.
     b) Es la memoria ampliable externa de un ordenador
    c) Es la parte física de un ordenador
    13) Qué significa DAC.
    a) Conversión analógico-digital.
    b) Conversión de datos antiguos.
    c) Conversión digital-.analógico..
    14) Qué significa ADC.
    a) Conversión analógico-digital.
    b) Conversión de datos antiguos.
    c) Conversión digital-.analógico.
    15) Son las fases de la ADC
     a) Muestreo, cuantización, mecanización
    b) Muestreo, cuantización, codificación.
    c) datación, cuantización, codificación...
    16)Un fotosensor es un conjunto de chips sensible a la luz,señala cual no lo es.
    a)ADC.
    b)CMOS
    c)CCD

    17) No es un dispositivo de almacenamiento moderno
    a) MP3.                       b) Blue Ray.                            c) Cinta perforada...
    18) Tipos de dispositivos utilizados en la tecnología de la información son:
    a) De recogida de datos, expulsión, reproducción, almacenamiento
    b) De recogida de datos, transmisión, reproducción, almacenamiento
    c) De recogida de datos, transmisión, reproducción, comunicación
    19)Son formatos de compresión de imagen:
    a)TIFF
    b)BMP
    c)JEPG(o JPG)
    d)GIF
    e)Todos.
    20)Son formatos de archivo de video o contenedores de multimedia:
    a)WMV y Divx
    b)MPEG,AVI,FLV,QuickTimeMovie,RealMedia,OGG...
    c)Todos ellos,( los primeros del primer tipo).
    15) Qué se entiende por bitrate;
    a) Tasa de transferencia de datos.
    b) Tasa de bits.
    c) Las dos anteriores
    16) ¿Qué es un pixel?
    a) La parte más pequeña de la pantalla del monitor es un punto cuadrado o rectangular.
    b) Es la menor unidad homogénea en color que forma parte de una imagen digital.
    c) a y b son correctas.
    17) ¿Qué es la resolución de color?
    a) Cantidad de bits por píxel
    b) Número de colores diferentes que se distinguen en una imagen.
    c) Es una unidad de medida de la cantidad de colores de una imagen en el monitor.
    21) ¿Qué es la resolución espacial?
    a) Cantidad de píxeles de una imagen
    b) Número de colores diferentes que se distinguen en una imagen.
    c) Es una unidad de medida de la cantidad de colores de una imagen en el monitor.
    19) El interfaz de comunicación ( es la comunicación que establece la CPU del ordenador con cada uno de los dispositivos periféricos (teclado, ratón, teléfono móvil conectado a USB,…)  se puede realizar:
    a) En serie y en paralelo. Esta última mediante dos hilos conductores y envío de bits simultáneamente.
    b) En serie y en paralelo. Esta última mediante un hilo conductor y envío de bits uno a uno
    c) En serie y en paralelo. Las dos mediante dos hilos conductores y envío de bits simultáneamente. .
    20) La compresión de datos se puede realizar.
    a) Con y sin pérdida de información, extensiones tipo JEPG(texto) y doc(imágenes) respectivamente
    b) Con y sin pérdida de información ,extensiones tipo JEPG(imágenes) y doc(texto) respectivamente..
    c) Sin y con pérdida de información, extensiones tipo JEPG(imágenes) y doc(texto) respectivamente
    21)Son códecs de audio sin pérdida de información
    a)MP3
    b)WAV.
    c)WMA



    22) Los medio de transmisión de datos se pueden realizar:
    a) Mediante conductores tipo bluetooth y sin cables tipo wíreless.
    b) Mediante conductores tipo fibra óptica y sin cables tipo coaxial.
    c) Mediante conductores tipo fibra óptica y sin cables tipo wíreless. .
    23) Un código se puede definir como el aspecto que toma una información que se intercambia, así no son totalmente códigos:
    a) Morse, siete segmentos, ASCII
    b) Morse, siete segmentos, braille
    c) X, siete segmentos, braille.

       Trabajemos las competencias: Competencia cultural y artística.

    La señalética

    24)¿Qué es un Backup?
    a) Es un sistema de antivirus.
    b) Es un sistema de copia de seguridad
    c) Es un sistema de seguridad en Internet.
    25) Un módem transmite por
    a) Kilobaudios
    b)Kilobits/seg
    c)Ninguna
    d)a y b.


    26) ¿Qué es el USB (bus universal en serie)?
    a) Es una interfase del tipo plug & play entre un ordenador y ciertos dispositivos
    b) Es un tipo de tarjeta aceleradora gráfica..
    c) Es un emulador para juegos de consola. .
    27) ¿Qué es un directorio?
    a) Identificación de uno o varios servidores conectados a la Red.
    b) Lugar en la red en donde se encuentra la información de modo jerárquico 
    c) Lenguaje de programación que permite establecer vínculos entre diferentes bloques de información y moverse rápidamente entre ellos.
    28) ¿Qué es el ORC(reconocimiento óptico de caracteres)
    a) Es una tecnología que permite la digitalización de un documento mediante un escáner.
    b) Es una red que distribuye paquetes desde y hacia sistemas locales
    c) Son las siglas de una organización dedicada a regular y desarrollar Internet..
    29) ¿Qúe es un dominio?
    a) Identificación de uno o varios servidores conectados a la Red.
    b) Lugar en la red en donde se encuentra la información de modo jerárquico 
    c) Lenguaje de programación que permite establecer vínculos entre diferentes bloques de información y moverse rápidamente entre ellos
    30) ¿Qué es el caché?
    a) Es un dispositivo de entrada de datos al ordenador mediante una punta fotosensible.
    b) Es un periférico que acelera la velocidad de conexión a Internet o a una Intranet.
    c) Es una sección de memoria de alta velocidad que almacena los datos más utilizados. .
    31) ¿Qué es "Hipertexto"?
    a) Identificación de uno o varios servidores conectados a la Red
    b) Lugar en la red en donde se encuentra la información de modo jerárquico 
    c) Lenguaje de programación que permite establecer vínculos entre diferentes bloques de información y moverse rápidamente entre ellos.
    32) ¿Qué es un servidor?
    a) Es un ordenador utilizado básicamente para conectarse a Internet.
    b) Es un ordenador central de un sistema de red que provee servicios y programas a otros
    c) Es un ordenador de tecnología avanzada utilizado para software complejo. .
    33) Es una via de acceso a Internet.:
    a) ADSL(El Asymmetric Digital Subscriber Line o Linea de Suscripci_on Digital Asimetrica).
    b) La FTTH (Fiber To The Home,fibra hasta el hogar).
    c) Cable modem.
    d) PLC.(Power Line Communications o Comunicaciones mediante Linea de Energía).
    e) LAN.
    f) Telefonía movil.
    g) RTC(red telefónica).
    h) RDSI.(red digital de servicios integrados).
    i)Todas lo son
    34) Toda la serie son servicios de Internet
    a) FTP,Telnet,OCR,e-mail
    b) SMTP,FTP,www,IRC.
    c) P2P,POP3,IP,webbus. .


    35) Quién es el creador de los e-mail y de la @:
    a) Taylor - Roberts..
    b) Wales - Sanger.
    c)Raymond Samuel Tomlinson
    d)Alan turing...

         Pasemos a otra cosa,te interesa el tema de las redes sociales?,pues conozcamos más sobre ellas.

    Cuestiones.
    1- 




                                            50'


    36) ¿Qué es un digg?
    a) Página que permite guardar y consultar los enlaces favoritos desde una web en lugar de tenerlos en un navegador de Internet.
    b) Es un buscador de blogs.
    c) Página que permite a los usuarios enviar, votar y jerarquizar las informaciones que hay en internet
    37) ¿Qué es un del.icio.us?
    a) Página que permite guardar y consultar los enlaces favoritos desde una web en lugar de tenerlos en un navegador de Internet.
    b) Página que permite a los usuarios enviar, votar y jerarquizar las informaciones que hay en internet
    c) Es un buscador de blogs
    38)¿Qué son los periféricos?
    a)Dispositivo conectado al ordenador
    b)Dispositivo que realiza operaciones complementarias a la CPU
    c)A y b son correctas
    39) ¿Qué es Technorati?
    a) Página que permite guardar y consultar los enlaces favoritos desde una web en lugar de tenerlos en un navegador de Internet.
    b) Fragmento de información almacenada en el disco duro que permite llevar un control de los usuarios.
    c) Es un buscador de blogs
    40) ¿Qúe es un cookie?
    a) Página que permite guardar y consultar los enlaces favoritos desde una web en lugar de tenerlos en un navegador de Internet
    b) Página que permite a los usuarios enviar, votar y jerarquizar las informaciones que hay en Internet
    c) Fragmento de información almacenada en el disco duro que permite llevar un control de los usuarios.
    41)En que generación de móviles aparecen las videollamadas:
    a)1G
    b)2G
    c)3G
    d)4G
    42) Los tipos de dispositivos de almacenamiento pueden ser(a parte de virtuales):
    a) Ópticos, magnéticos, magneto-ópticos y de memoria sólida.
    b) Ópticos ,magnéticos, sólido-ópticos y de memoria sólida..
    c) Ópticos, magnéticos, sólido-magnéticos y de memoria sólida. .
    43)El uso de la telefonía móvil requiere una infraestructura básica que consta de:
    a)Antenas,bases y conmutadores
    b)Satélites,Estaciones y receptor.
    c)Antenas,estaciones base y nódulos de conmutación.


    44) Es un condensador:
    a) Conjunto de circuitos integrados
    b) Dispositivo que recibe, transforma y gestiona información según un programa (software) establecido
    c) Dispositivo que almacena cargar eléctricas. .
    45)Un navegador  GPS consta de tres componentes:
    a)Antenas,bases y conmutadores
    b)Satélites,estaciones y receptor.
    c)Antenas,estaciones base y nódulos de conmutación

    46) Es un procesador:
    a) Conjunto de circuitos integrados.
    b) Dispositivo que recibe, transforma y gestiona información según un programa (software) establecido
    c) Dispositivo que almacena cargar eléctricas.
    47)Son sistemas de localización:
    a)Xbox,GPS y GLONASS
    b)SIM,Glonass y Galileo.
    c)Galileo,GPS y GLONASS.


        Trabajemos las competencias clave:CD,CD,CS

    -Describe una actividad cotidiana en la que necesites el GPS

    48) Podemos encontrar microprocesadores en:
    a) Consolas. Móviles
    b) Cámaras fotográficas y televisores
    c) Todos.
    49) Son proveedores de acceso a internet:
    a)IPv4
    b)IP
    c)IPv6
    d)Todas.
    50) Es un chipset:
    a) Conjunto de circuitos integrados
    b) Dispositivo que recibe, transforma y gestiona información según un programa(sofware) establecido.
    c) Dispositivo que almacena cargar eléctricas.
    51)Son protocolos para conexiones inalámbricas entre móviles.
    a)WAP
    b)i-mode
    c) a y b
    52) ¿A qué tipo de periférico corresponde un CD-ROM?:
    a) A tecnología óptica
    b) A tecnología de papel.
    c) A tecnología magnética. 
    53) Las web 1.0,web 2.0 y web 3.0 son términos que aluden a la evolución progresiva de la www o telaraña mundial.¿Cual de ellas se puede relacionar con la calificación de web social o interactiva?
    a)La web 1.0
    b) La web 2.0
    c)La web 3.0
    54) ¿A qué tipo de periférico corresponde un disco rígido?
    a) A tecnología directa
    b) A tecnología magnética.
    c) A tecnología óptica
    55) No es un sitio de intercambio de multimedia
    a)Imstagram
    b)Odeo
    c)Flikr
    d) SSH(alternativa a Telnet)
    56) ¿Cuál de los siguientes es el mayor múltiplo del byte?:
    a) Gbyte
    b) Ybyte.
    c) Mbyte
    57) Son programas de recuperación de datos.
    a)Recuva
    b)Pandora Recovery
    c)Undelete 360
    d) Todos
    58) ¿Qué aplicación nos permite mostrar páginas Web?
    a) Un protocolo.                   
    b) Un navegador.                    
    c) Un servidor.
    59)No es un servidor de almacenamiento de la nube
    a)GoogleDrive
    b)Banner
    c)Icloud
    d)Dropbox
    60) ¿Qué es un protocolo?
    a) Conjunto de normas y convenciones que permiten el flujo de información entre dispositivos u ordenadores distintos que manejan lenguajes distintos.
     b) Un programa o dispositivo que realiza una acción en representación de otro
     c) Cadena de caracteres con la cual se asigna una dirección única a cada uno de los recursos de información disponibles en la Internet
    61) No es un proyecto que utiliza la tecnología "grid" (generador de superordenador virtual)
    a)SETI@home
    b)Golem@home
    c)EELA
    d) Todos lo son
    62) ¿Qué es un navegador?
    a) Conjunto de normas y convenciones que permiten el flujo de información entre dispositivos u ordenadores distintos que manejan lenguajes distintos.
    b) Un programa o dispositivo que realiza una acción en representación de otro.
    c) Programa que interpreta el código HTML lo que permite explorar las páginas web.
    63) No son navegadores:
    a) Internet Explorer y Opera.              b) Firefox y Konqueror.          c) Windows y Linux.
     64) Los lenguajes de programación adaptados a la web se llaman:
    a) Scripts, como JavaScript   b) Firefox y Konqueror.          c) Windows y Linux.
     65) No es un servicio de búsqueda de información web:
    a) Motores de búsqueda, como Google
    b) Firefox y Konqueror
    c) Directorios

        Ya salió google,veamos un docu:

    Cuestiones:
        1-En el docu sale una magnitud equivocada cuyo nombre se ha inspirado en "google", pon atención , investiga el término y descubre el error.


                                              45' 

    66) ¿Qué se entiende por LAN?
    a) Redes locales que conectan ordenadores de una misma empresa o institución.
    b) Un protocolo que establece la correspondencia entre un IP y los nombres de dominio.
    c) Un servidor.
    67)Los tres subsistemas que forman un ordenador son:
    a)CPU,memoria y Buses
    b)CPU,BIOS y Memoria
    c)CPU,memoria y unidades de entrada y salida.
    68) ¿Qué se entiende por WAN?
    a) Redes locales que conectan ordenadores de una misma empresa o institución.
    b) Un protocolo que establece la correspondencia entre un IP y los nombres de dominio.
    c) Red de área amplia comúnmente compuesta por varias LAN interconectadas por medio de fibra óptica o enlaces aéreos, como satélites
    69)La placa base del ordenador (macrocircuito impreso)consta de:
    a)Zócalo del microprocesador, chipset y Bios
    b)Ranuras de expansión y de memoria
    c)Buses y puertos de comunicación
    d)Todos ellos
    70) ¿Qué se entiende por WLAN?
    a) Redes locales que conectan ordenadores de una misma empresa o institución.
    b) Red que comienza a que se basa en la transmisión de datos mediante ondas de radio, microondas, satélites o infrarrojos
    c) Red de área amplia comúnmente compuesta por varias LAN interconectadas- en una extensa área geográfica- por medio de fibra óptica o enlaces aéreos, como satélites.
    71)Las partes de una CPU(unidad central de procesamiento) son:
    a)UC(unidad de control) y reloj
    b)ALU)unidad aritmético lógica y núcleos
    c)Núcleos y reloj
    d)Todas ellas.
    72) ¿Qué se entiende por VLAN?
    a) Redes locales que conectan ordenadores de una misma empresa o institución.
    b) Red local que se crea con grupos de usuarios que tengan requerimientos similares o que compartan un conjunto de recursos, como impresoras y servidores, pero que no necesariamente están ubicados de manera física en un mismo lugar
    c) Red de área amplia comúnmente compuesta por varias LAN interconectadas- en una extensa área geográfica- por medio de fibra óptica o enlaces aéreos, como satélites.

    73) ¿Qué es checkdialer?
     a) Página que permite guardar y consultar los enlaces favoritos desde una web en lugar de tenerlos en un navegador de Internet..
    b) Programa que monitoriza las conexiones a través de un módem
    c) Fragmento de información almacenada en el disco duro que permite llevar un control de los usuarios..
    74) ¿Qué es un IP?
    a) Un navegador.                    b) Un protocolo.                      c) Un servidor.
    75)  ¿Qué se entiende por PLC?
    a) Redes locales que conectan ordenadores de una misma empresa o institución.
    b) Conexión a internet por medio de cable y un decodificador
    c) Red de área amplia comúnmente compuesta por varias LAN interconectadas- en una extensa área geográfica- por medio de fibra óptica o enlaces aéreos, como satélites.
    76) ¿Qué se entiende por DNS?
     a) Un navegador.
     b) Un protocolo que establece la correspondencia entre un IP y los nombres de dominio.
     c) Un servidor.
    77) ¿Qué es un cortafuegos?
    a) Un navegador que reduce la temperatura del portátil.
    b) Un sistema para bloquear accesos no autorizados.
    c) Un proveedor de servicio.
    78) ¿Qué es ISP?
    a) Un navegador
    b) Un protocolo
    c) Un proveedor de servicio de internet
    79)Son servicios de alojamiento de archivos.
    a) Dropbox
    b) Google drive
    c) Mega
    d) Todos
    80) ¿Quién es el artífice de ARPANET?
    a) Kahn y Cerf
    b) Taylor y Roberts
    c) Wales y Sanger
    81) ¿Quién está detrás del protocolo TCP/IP?
    a) Kahn y Cerf
    b) Tim Berners-Lee.
    c) Taylor y Roberts.
    82) ¿Quién inventó la WWW?
    a) Kahn y Cerf
    b) Tim Berners-Lee 
    c) Taylor y Roberts
    82') ¿Quién introdujo el sistema operativo Linux?
    a) Tim Berners-Lee 
    b) Linus Torvalds
    c) Wales y Sanger

      Curso 2016/17

    83) ¿Quién está detras de la wikipedia?
    a) Kahn y Cerf
    b)Tim Berners Lee
    c) Wales y Sanger
    84)  ¿Qué es un proxy?
    a) Un programa o dispositivo que realiza una acción en representación de otro
    b) Cadena de caracteres con la cual se asigna una dirección única a cada uno de los recursos de información disponibles en la Internet.
    c) Una aplicación software que permite al usuario recuperar y visualizar documentos de hipertexto.
    85) ¿Qué es URL?
    a) Una aplicación software que permite al usuario recuperar y visualizar documentos de hipertexto.
    b) Cadena de caracteres con la cual se asigna una dirección única a cada uno de los recursos de información disponibles en la Internet
    c) Un programa o dispositivo que realiza una acción en representación de otro.
    86) También es un navegador
    a) Un programa o dispositivo que realiza una acción en representación de otro.
    b) Cadena de caracteres con la cual se asigna una dirección única a cada uno de los recursos de información disponibles en la Internet.
    c) Una aplicación software que permite al usuario recuperar y visualizar documentos de hipertexto.
    87) ¿Qué es un Software?
    a) Programa o lenguaje lógico para comunicarse con el ordenador
    b) Todo aquel programa que se distribuya gratuitamente, con ningún coste adicional.
    c) Programa que se distribuye con limitaciones, bien como versión de demostración o evaluación, con funciones o características limitadas o con un uso restringido a un límite de tiempo establecido.
    88)Qué es un firmware?
    a) Programa o lenguaje lógico para comunicarse con el ordenador.
    b) Todo aquel programa que se distribuya gratuitamente, con ningún coste adicional.
    c) Conjunto de instrucciones en la ROM para controlar los componentes electrónicos.
    89) ¿Qué es un Software libre?
    a) Se tratan de programas de Código Abierto (Open Source) y es ahí donde reside la esencia de su libertad: los programas bajo licencias GPL, una vez adquiridos, pueden ser usados, copiados, modificados y redistribuidos libremente, no tienen por qué ser gratuitos..
    b) Todo aquel programa que se distribuya gratuitamente, con ningún coste adicional.
    c) Programa que se distribuye con limitaciones, bien como versión de demostración o evaluación, con funciones o características limitadas o con un uso restringido a un límite de tiempo establecido.

    90)¿Qué es un bloatware?
    a) Programa o lenguaje lógico para comunicarse con el ordenador.
    b) Todo aquel programa que se distribuya gratuitamente, con ningún coste adicional.
    c) Programa que se distribuye con limitaciones, bien como versión de demostración o evaluación, con funciones o características limitadas o con un uso restringido a un límite de tiempo establecido.
    d)Conjunto de aplicaciones preinstaladas en un smartphone.
    91) ¿Qué es un Freeware?
    a) Programa o lenguaje lógico para comunicarse con el ordenador
    b) Todo aquel programa que se distribuya gratuitamente, con ningún coste adicional.
    c) Programa que se distribuye con limitaciones, bien como versión de demostración o evaluación, con funciones o características limitadas o con un uso restringido a un límite de tiempo establecido
    d)Conjunto de aplicaciones preinstaladas en un smartphone


    92)Un software incluye:
    a)Sistema operario ,un firmware,conductor y otros programas
    b)Sistema operativo ,un firmware,driver y otros programas.

    c)Sistema operario ,un firmware,conductor y otros programas
    93) ¿Qué es un Shareware?
    a) Programa o lenguaje lógico para comunicarse con el ordenador.
    b) Todo aquel programa que se distribuya gratuitamente, con ningún coste adicional.
    c) Programa que se distribuye con limitaciones, bien como versión de demostración o evaluación, con funciones o características limitadas o con un uso restringido a un límite de tiempo establecido Un ejemplo es el software antivirus
    94)No es un sistema operativo
    a)Windows
    b)Unix
    b)Mac OS X
    c)GNU/Linux
    d)Ninguno.
    95) ¿Qué es un spyware?
    a) Cualquier programa que automáticamente se ejecuta, muestra o baja publicidad al computador después de instalado el programa o mientras se está utilizando la aplicación.
    b) Es un software que tiene como objetivo infiltrarse en o dañar un ordenador.
    c) Aplicación que recopila información sobre una persona u organización sin su conocimiento El software de Kazaa, por ejemplo, instala además del programa principal otros que envían publicidad a tu ordenador según tus preferencias de navegación.
    El Malware, Virus, Hacker, Troyano
    96)No es un sistema operativo para móviles
    a)Android
    b)iOS
    b)Symbian
    c)WindowsPhone
    d)Ninguno.
    97) ¿Qué es un Malware?
    a) Es un software que tiene como objetivo infiltrarse en o dañar un ordenador
    b) Aplicación que recopila información sobre una persona u organización sin su conocimiento. c)Cualquier programa que automáticamente se ejecuta, muestra o baja publicidad al computador después de instalado el programa o mientras se está utilizando la aplicación.

    98)Son distintas versiones(distribuciones) del S.O libre Linux:
    a)Ubuntu
    b)Colembutu
    b)Lliurex
    c)Molinux
    d)Todas.

    99) ¿Qué es un adware?
    a) Aplicación que recopila información sobre una persona u organización sin su conocimiento.
    b) Es un software que tiene como objetivo infiltrarse en o dañar un ordenador.
    c) Cualquier programa que automáticamente se ejecuta, muestra o baja publicidad al computador después de instalado el programa o mientras se está utilizando la aplicación. Un ejemplo el programa Messenger de Microsoft..


    100)Son programas de aplicación del tipo paquetes ofimáticos o suites:
    a) Office
    b) iWork
    c) Open office
    d)Todos.
    101) Qué es un bot o botnet:
    a) Un malware.
    b) Un ordenador Zombi.
    c) Un programa espía.
    102)Son funciones de las suites los procesadores de texto, presentaciones y hojas de cálculo entre las segundas está:
    a) Word
    b) Excel
    c) Prezi

    Enlace

    Evaluación de los prezis fin de tarea:

       Se votará en clase de 1 al 10 los siguientes aspectos del prezi:

    1-Plantilla elegida.
    2-Coherencia argumental.
    3-Elemento audiovisual vídeo.
    4-Música de fondo.
    5-Valoración general.

    Ejemplo de prezi

    103) Qué es un hacker (pirata informático o ciberpirata):
    a) Un criminal informático.
    b) Un programador capaz de mejorar el rendimiento de determinados dispositivos.
    c) El uno, el otro o los dos



    -En el mundo hacker a un  hacker "BUENO" se le llama: a)ciberhood b) sombrero negro c) sombrero blanco.
    -Es la entidad de referencia para el desarrollo de la ciberseguridad ,red académica y de investigación, profesionales, empresas y especialmente para sectores estratégicos: a)INTECO b) INCIBE. c) SESIAD..


     Te apetece saber más: Vídeo "Mundo Hacker"
    Docu de 40'

       O quizás una película: Hacker, ningún sistema es seguro V.O.S.

     Audio latino





    104) ¿Señala la afirmación correcta sobre el LED?
    a) Significa Ligth emitting diode 
    b) Es un componente electrónico que emite luz cuando se polariza 
    c) Un tipo es el RGB(tiene tres semiconductores cada uno emite una luz,R=red,G=green,B=blue) 
    d) Todas son correctas.
    105) ¿Qué se entiende por Telnet?
    a) Es un protocolo de red para la transferencia de archivos entre sistemas conectados a una red TCP.
    b) Un protocolo de red (y del programa informático que implementa el cliente), que sirve para acceder mediante una red a otra máquina, para manejarla remotamente.
    c) Una red que no tiene clientes ni servidores fijos, sino una serie de nodos que se comportan simultáneamente como clientes y como servidores respecto de los demás nodos de la red.
    d) Es una forma legal de compartir archivos.
    106)Ventajas de los LED respecto a las lamparas tradicionales son:
    a) No emiten calor 
    b) Duran más 
    c) Mayor eficacia lumínica 
    d)Todas ellas.

    107) ¿Qué se entiende por P2P?
    a) Una red que no tiene clientes ni servidores fijos, sino una serie de nodos que se comportan simultáneamente como clientes y como servidores respecto de los demás nodos de la red
    b) Es una forma legal de compartir archivos.
    c) Un protocolo de red (y del programa informático que implementa el cliente), que sirve para acceder mediante una red a otra máquina, para manejarla remotamente.
    d) Es un protocolo de red para la transferencia de archivos entre sistemas conectados a una red TCP.
    108)Se entiende por acceso root o rootear:
    a) Una red que no tiene clientes ni servidores fijos, sino una serie de nodos que se comportan simultáneamente como clientes y como servidores respecto de los demás nodos de la red.
    b) Es una forma legal de compartir archivos.
    c) Un protocolo de red (y del programa informático que implementa el cliente), que sirve para acceder mediante una red a otra máquina, para manejarla remotamente.
    d)Tener el permiso para poder acceder y utilizar partes del sistema operativo en las aplicaciones, que siendo usuario normal no podríamos
    109) ¿Qué se entiende por POP3?
    a) Protocolo para poder leer correo electrónico en Internet..
    b) Un protocolo de red (y del programa informático que implementa el cliente), que sirve para acceder mediante una red a otra máquina, para manejarla remotamente.
    c) Es un protocolo de red para la transferencia de archivos entre sistemas conectados a una red TCP.

    110)Cual de los siguientes medios de transmisión es más rápido:
    a)Bluetooth
    b)wi-fi
    c)Infrarrojos

    111) ¿Qué se entiende por SMTP?
    a) Protocolo para poder leer correo electrónico en Internet
    b) Protocolo simple de transmisión de correo
    c) Es un protocolo de red para la transferencia de archivos entre sistemas conectados a una red TCP
    112) ¿Qué se entiende por HTTP?
    a) Protocolo para poder leer correo electrónico en Internet
    b) Protocolo simple de transmisión de correo
    c) Protocolo de transferencia de hipertexto
    113) ¿Qué se entiende por FTP?
    a) Un protocolo de red (y del programa informático que implementa el cliente), que sirve para acceder mediante una red a otra máquina, para manejarla remotamente.
    b) Es un protocolo de red para la transferencia de archivos entre sistemas conectados a una red TCP
    c) Una red que no tiene clientes ni servidores fijos, sino una serie de nodos que se comportan simultáneamente como clientes y como servidores respecto de los demás nodos de la red.
    d) Es una forma legal de compartir archivos.
    114) ¿Qué se entiende por RSS?
    a) Protocolo para poder leer correo electrónico en Internet
    b) Protocolo simple de transmisión de correo
    c) Familia de formatos de fuentes web codificados en XML
    d) Se utiliza para suministrar a suscriptores información actualizada frecuentemente
    115) ¿Qué se entiende por podcasting?
    a) Protocolo para poder leer correo electrónico en Internet.
    b) Protocolo simple de transmisión de correo.
    c) Consiste en la creación de archivos de sonido y de video y su distribución ,permite suscribirse y usar un programa que lo descarga de Internet para que el usuario lo reproduzca cuando quiera..
        Hablando de internet veamos un documental:
    Cuestiones:
    1-




       49'

    116) ¿Qué se entiende por Bus?
    a) Cualquier arreglo físico que puede conectar lógicamente varios periféricos sobre el mismo conjunto de cables. (Ej. Un usb).
    b) Ventanas que emergen automáticamente (generalmente sin que el usuario lo solicite) mientras se accede a ciertas páginas Web..
    c) Una red que no tiene clientes ni servidores fijos, sino una serie de nodos que se comportan simultáneamente como clientes y como servidores respecto de los demás nodos de la red..
    d) Es una forma legal de compartir archivos. ...
    117) Son buenos consejos para comprar on-line:
    a)Verificar la fuente y revisar  los datos de pago(candadito en la http)
    b)Tener antivirus y contraseñas
    c)Evitar las redes wifi abiertas
    d)Todas.
    Backup De Datos, Política De Privacidad

      ¿Crees que existe algo gratis? Descrúbelo en el siguiente docu.




    118) ¿Qué se entiende por pop-ups?
    a) Un protocolo de red (y del programa informático que implementa el cliente), que sirve para acceder mediante una red a otra máquina, para manejarla remotamente.
    b) Es un protocolo de red para la transferencia de archivos entre sistemas conectados a una red TCP.
    c)”Ventanas emergentes” en las páginas web

    119)Es el inventor de la transmisión inalámbrica: a) Ada Lovelace b) Hedy Lamarr c)Stephanie Kwolek

    81) Es una tecnología inalámbrica para grandes distancias
    a) Bluetooth .
    b) Wireless.
    c) Wimax.
    120) El término cloud computing, computación en nube o “la nube” hace referencia a :
    a) Dispersión de datos en la red.
    b) Almacenamiento remoto.
    c) Ninguno.
    121) Son canales a través de los cuales viaja la información:
    a) Cable de cobre
    b) Cable coaxial
    c) Fibra óptica
    d) Ondas de alta frecuencia
    e) Todas.
    122) Son patologías asociadas al uso abusivo de las TIC:
    a) Síndrome visual del ordenador (se parpadea 3 veces menos de lo normal)
    b) Wiititis (tendintis)
    c) Síndrome del ratón (hiperextensión de la mano)
    d) Runnorexia
    e) a y b.
    123) Síndrome de padecimiento de los músculos esqueléticos por abuso de los dispositivos móviles:
    a)Tex nek
    b)Nec Text        
    c)Text Neck
    d) Todas


       Test ampliación.


    124-Que otro nombre recibe la placa base:
    a)Placa madre
    b)Tarjeta madre
    c)A y b
    Picture
    125-Sobre la tarjeta gráficade vídeo,aceleradora...):
    a)Es el dispositivo encargado de procesar los datos y pasarlos a la pantalla
    b)Casi todos los ordenadores la tienen integrada en la placa base
    c)Se necesita otra más para determinados programas o juegos
    d)Todas las anteriores


    126-Cada ordenador tiene una dirección IP, un nº de 4 bytes(byte=octeto) con un formato 000.000.000.000,cada grupo de tres ceros puede tomar un valor entre:
    a) 0 y 255
    b)1 y 255
    c)0 y 244
    d)1 y cualquiera de tres cifras.

    127-¿Qué se entiende por hijackers?
    a) Son secuestradores de navegadores
    b) Software que cambia la configuración de los navegadores
    c) Son un tipo de piratas informáticos
    d) Todas las anteriores


    128-¿Qué se entiende por puertas traseras?
    a)Un tipo de hardware para manipular un pc
    b)Un tipo de hardware para controlar un pc remotamente
    c)Un tipo de software para controlar un pc remotamente
    d)Un tipo de software para controlar un pc
    129-El ADSL es un método de transmisión de :
    a) Imágenes y datos de bajada y subida
    b) Imágenes y datos de subida y bajada
    c) Voz  y datos de subida y bajada
    d) Todas
    130-Las siglas HFL en internet hacen referencia a:
    a) Una combinación de cable y fibra óptica.
    b) Una hoja de fibra lumínica
    c) Ninguna
    d) a y b
    131-¿Qué es o significa  RAT?
    a)Herramienta de acceso remoto
    b)Transportador de acceso remoto
    c)Transportador de acceso recíproco
    d)Ninguna
    132) ¿Qué es un ransomware?
    a) Aplicación que recopila información sobre una persona u organización sin su conocimiento.
    b) Es un software que tiene como objetivo infiltrarse en o dañar un ordenador.
    c) Cualquier programa que automáticamente se ejecuta, muestra o baja publicidad al computador después de instalado el programa o mientras se está utilizando la aplicación. Un ejemplo el programa Messenger de Microsoft..
    d)Software que inpide o limita el acceso a arachivos.
    What is Hybrid fibre-coaxial

    133-¿Qué se entiende por LIFI?
    a)Programa de ayuda
    b)Red de transmisión de datos por la luz
    c)Acrónimo de light fidelity
    d)b y c son correctas.
    134-El nº de dispositivos basados en el internet de las cosas es de:
    a)1000 millones
    b)3000 millones
    c)4500 millones
    d) 6000 millones

    135-Entre los llamados Add-ons(plugins,snap-ins), programas que sólo funcionan anexados a otro y que sirven para incrementar o complementar sus funcionalidades, tenemos:
    a)Las barras de Google
    b)La barra de Yahoo
    c)Complementos de Mozilla
    d)Todos.

    136-Programa informático que publica (u otra acción)por ti cada cierto tiempo.
    a) Bon
    b) Bot
    c) Los hay de twitter,youtube,instagramm...
    d) b y c

    137-Micromecenazgo a pequeñas empresas:
    a)Crowsourcing
    b)Bitcoin
    c)Crowfounding
    d) a y c

    138-Ofrecimiento a los internautas de participar en empresas:
    a)Crowsourcing
    b)Bitcoin
    c)Crowfounding
    d) a y c

    139-Moneda digital:

    a)Crowsourcing
    b)Bitcoin
    c)Crowfounding
    d) Bitchoin




    Tarea 1
     Prepara una redacción de 5 líneas sobre lo que te sugiere el vídeo.

    Tarea 2 Los peligros en la red

                    8'

                                    TEMAS




       La obsolescencia programada.



                  Las plataforma colaborativas

    Una plataforma de trabajo colaborativo es un espacio virtual de trabajo, o sea, una herramienta informática (con frecuencia un sitio digital en Internet), que centraliza todas las funcionalidades ligadas a la conducción de un proyecto, la gestión de conocimientos y/o el funcionamiento de una organización,1 poniendo las mismas a disposición de los diferentes actores involucrados.


                        LOS OPERADORES BOOLEANOS



    ¿Cómo utilizar los operadores booleanos?

    La pregunta se relaciona con la fuente Lilacs
     Los llamados operadores lógicos o booleanos más universales son: AND, OR, NOT (del matemático George Boole, 1815-1864). 

    Sin embargo depende del buscador :
    Así el buscador google hace uso de los operadores booleanos para realizar búsquedas combinadas de varios términos. Esos operadores son una serie de símbolos que Google reconoce y modifican la búsqueda realizada:
    • " ": Para buscar una expresión literal.
    • -: Para excluír páginas que incluyan cierto término.
    • corte -ingles (compara con corte).
    • OR (ó |): Busca páginas que contengan un término u otro.
    • +: Para incluír palabras que Google por defecto no tiene en cuenta al ser muy comunes (en español: "de", "el", "la".....).
    • +la real (compara con la real).
      También se usa para que Google distinga acentos, diéresis y la letra ñ, que normalmente son elementos que no distingue.
    • *: Comodín. Utilizado para sustituir una palabra. Suele combinarse con el operador de literalidad (" ").
    AND
    Es la intersección de los dos conjuntos de búsqueda. Apareciendo en el resultado únicamente los elementos que aparecen en los dos conjuntos. Es un operador de reducción. 
    Ejemplo:   Diabetes AND Tipo 1.

    Es decir, la Diabetes Tipo
    OR
    El operador lógico OR (O) es el operador para la unión de conjuntos. Se utiliza para ampliar el enfoque de la búsqueda e incrementa por lo general, el número de documentos a recuperar.
    Al utilizar OR se indica al buscador que se desea recuperar documentos donde aparezca uno, otro o al menos uno de los argumentos indicados. Siempre se utiliza para añadir o sumar elementos en la estrategia de búsqueda. El operador OR es especialmente útil para indicar asociaciones de palabras o sinónimos en la estrategia de búsqueda.

    Ejemplo:  Asma OR neumonía atípica.
    AND NOT o NOT
    El operador AND NOT o NOT es el operador de exclusión de conjuntos. El resultado de este operador son los registros que contienen los elementos del primer conjunto y que no son los del segundo. AND NOT o NOT es muy útil para minimizar los problemas ocasionados por la polisemia. Generalmente, se utiliza después de explorar de forma preliminar los resultados devueltos por el buscador, y así refinar de la búsqueda los resultados irrelevantes. Hay que tener precaución con su uso, ya que puede representar la pérdida de documentos relevantes; y revisar la ayuda del buscador para comprobar si utiliza la expresión AND NOT o la palabra NOT o sus equivalentes en español. (y no, no).
    Ejemplo: antibióticos AND NOT penicilina

    La combinación de los operadores boléanos, y la utilización de paréntesis y comillas, permite construir complejas estrategias de búsqueda. En todos los casos, el operador elegido, debe estar precedido y antecedido de espacio, es decir, no deben estar unidos a ninguna palabra.
    En algunos buscadores se utilizan los signos matemáticos más (+) y menos (-) en sustitución de los operadores lógicos AND (+) y AND NOT o NOT (-). En ambos casos, el signo correspondiente se coloca delante de la palabra clave, sin dejar espacios.
    Ejemplo: asma+hipertensión.  






       

               Mobeye, la app que te permite ganar dinero
                              con   tu smartphone.




                            VÍCTIMAS DE FACEBOOK

                        



    2 comentarios: